Blog

TM Shamaila^1,2,;  K Ndashe^3,4  ; C Kasase²; M Mubanga⁵;  L Moonga⁵; J Mwansa⁴; BM Hang’ombe⁵
 1. Ministry of Fisheries and Livestock, P.O Box 38111, Monze, Zambia
2. Department of Public Health, School of Health Sciences, University of Lusaka, Lusaka, Zambia.
3. Department of Environmental Health, Faculty of Health Science, Lusaka Apex Medical University, Kasama Road, Lusaka, Zambia.
4. Department of Microbiology, Faculty of Medicine and Surgery, Lusaka Apex Medical University, Kasama Road, Lusaka, Zambia.
5. Department of Para clinical Studies, School of Veterinary Medicine, The University of Zambia, PO Box 32379, Lusaka, Zambia.
Correspondence: Kunda Ndashe (ndashe.kunda@gmail.com)
Download PDF

Citation style for this article: Shamaila TM, Ndashe K, Kasase C, et al. Inva Gene And Antibiotic Susceptibility Of Salmonella Spp Isolated From Commercially Processed Broiler Carcasses In Lusaka District, Zambia. Health Press Zambia Bull. 2018;2(6); pp 6-12.

Poultry meat is considered to be one of the major vehicles of Salmonella infections in humans and has been implicated in outbreaks of Salmonellosis in humans. The potential for mass outbreaks of Salmonellosis is likely to be linked to the high consumption of poultry meat and the increasing antibiotic resistance of Salmonella spp poses a huge challenge to treatment of the foodborne infection. Determination of virulence genes such as InvA is important as they play a vital role in the establishment and invasion of Salmonella spp in the gastrointestinal tract of the host and therefore is means of detection of the virulence of the pathogen and it is the international standard in the detection of Salmonella spp using molecular techniques.
This was a cross-sectional study where two abattoirs were sampled conveniently in Lusaka district. A total of 100 swabs were collected from the 2 abattoirs and submitted to the University of Zambia, School of Veterinary Medicine, Paraclinical Sciences laboratory were isolation and identification bacteria was conducted. Presumptive Salmonella colonies were further analysed through conducting biochemical tests, molecular detection of the virulence gene invA through polymerase chain reaction and antibiotic susceptibility testing.
The study revealed that 2% of commercially broiler carcasses were contaminated with Salmonella spp. The isolates further showed resistance to two antibiotics, gentamicin and tetracycline after antimicrobial susceptibility testing.
The presence of Salmonella spp with a virulence gene (InvA) in commercially processed broilers is a public health concern mostly in sensitive population and multi-drug resistance of the pathogen presents challenge in treatment options of Salmonellosis.
INTRODUCTION
Salmonellosis is a major public health concern and cases have been attributed to poultry and poultry products [1]. Contamination of poultry can occur through the whole production chain, from the farm to the abattoir [2]. Reports on the contamination of the broiler carcasses in abattoirs and in retail shops have been published by various workers [3-5] and among other reasons it is due to inappropriate handling and hygiene conditions [6]. Transport in inadequately cleaned and disinfected containers [7], cross-contamination by the slaughter environment or by Salmonella-contaminated flocks to the carcasses of Salmonella-free flocks are identified as possible risk factors in the abattoir [8, 9]. At slaughter, the gastrointestinal tract may harbour Salmonella and may be damaged during the evisceration, resulting in contamination of poultry carcasses [10].
For human two main pathways of exposure to salmonella in poultry meat have been identified and these are undercooking and cross-contamination [11]. During the cooking procedure, fairly high temperatures occur on the outside of meat but may not be sufficient to kill bacterial pathogens inside [12]. The contaminated undercooked poultry meat is then associated with bacterial pathogens located inside the chicken meat and serves as an exposure pathway humans [12].
The constant use of antimicrobial agents in poultry production for palliative and curative purposes as well as growth promotion is contributing factor to the emergence of antibiotic resistant bacteria that are subsequently transferred to humans through the consumption of undercooked poultry meat [13]. The use of antibiotics as growth promoter has been banned in many countries globally but antimicrobial use regulation is still a challenge in many developing countries [13]. Misuse of antimicrobials is facilitated in developing countries by their availability over the counter, without prescription and through unregulated supply chains [14].
There are over 2500 serovars of Salmonella, but only a few are commonly associated with human disease [15]. The pathogenic process of salmonellosis is usually dictated by an number of virulence genes that act in tandem and ultimately manifest in the typical symptoms of salmonellosis [16]. The virulence genes are encoded within the Salmonella pathogenicity islands (SPI) on the chromosome as units of large cassettes and these genes encode products that assist the organism in expressing its virulence in the host cells [17]. These products are produced as effector proteins and include invA, sipA, sipB, sipC, sifA, hilA, hilC, hilD and invF [18]. The distribution of these genes among the various isolates obtained from biological sources may be important in indicating the clinical significance of Salmonella [19]. The invA gene of Salmonella contains sequences unique to this genus and has been proved to be a suitable PCR target with potential diagnostic application [20]. This gene is recognized as an international standard for detection of Salmonella genus [21]. The invA gene plays a vital role in the establishment and invasion of Salmonella spp in the gastrointestinal tract of the host and therefore its detection serves as a means of determination of the virulence of the pathogen [22].
Zambia has recorded an increase in annual poultry production from 13 to 76 million broiler chickens between the 1990’s to 2016 [23]. The growth of the poultry industry has seen an increase in the source of proteins for the local population and for export to neighbouring countries [24]. The financial potential of the fast expanding poultry industry has provided opportunities for establishment of commercial abattoirs where chickens are slaughtered, processed and packaged for the retail market. Owing to processing and packaging of poultry for the market, it is important that the meat is superior in quality and free of Salmonella contamination to ensure that the consumers are protected from any possible foodborne infection [25]. It was therefore imperative that a study was conducted on Salmonella spp in commercially processed broiler carcasses to determine its prevalence, antibiotic susceptibility and presence of the virulence gene (invA).
MATERIALS AND METHODS
This was a cross-sectional study conducted in Lusaka district, Zambia. The district has five commercial semi-automated poultry abattoirs of which only two (A and B) granted permission to conduct the study from their premises. The chickens processed at the two abattoirs are distributed in supermarkets and sold to consumers countrywide.
One hundred (100) samples were collected, 50 from each abattoir. The two abattoirs were sampled conveniently and swabs were collected using systematic random sampling method. Every 25^th processed broiler carcass was swabbed on the visceral and cloacal surfaces using the one swab, this was done just before being packaged and consequently taken for refrigeration. The cloacal and visceral surfaces were swabbed because they have been reported to harbour more gastrointestinal contents in cases of contaminations [26]. Each swab was then placed in test tube with selenite broth and stored in a cooler box before being transported to the laboratory.
The swabs collected in selenite broth were incubated for 24hours at 37˚C after which they were cultured on Blood agar (Himedia, India), Maconkey agar (Himedia, India) and xylose lysine deoxycholate (XLD) agar (Himedia, India) at the same incubation conditions. Gram staining was performed on the colonies from XLD and Maconkey agars and bacteria that were identified as presumptive Salmonella spp was further inoculated Triple sugar iron agar (TSI) agar (Oxoid, UK) and SIM agar (Oxoid, UK), which were incubated at 37˚C for 18hours. Other biochemical tests for the salmonella spp isolates included; Urease, citrate and Methyl Red Voges Proskauer (MRVP) media (Oxoid, UK).
The colonies identified as salmonella spp were then subjected to serotyping by slide agglutination, according to the Kaufmann- white classification using salmonella polyvalent O and H antisera (Denka Seiken co., Tokyo, Japan).
DNA from the enriched culture was extracted by heating for 10-20min on a heating block. The DNA was used as the template for the PCR assay and the primers pair used targeted the invA gene and are shown below;
22 mer Sal141- 5’ TCATCGCACCGTCAAAGGAACC 3’
26 mer Sal139 –5’ GTGAAATTATCGCCACGTTCGGGCAA 3’
The total mixture for each sample came up to 25µl (24µl of master mix+ 1µl DNA template). The Master mix was prepared as follows;(a) 10× Buffer (2.5µl), (b) dNTP (2.0µl), (c) Primer (forward and reverse) 1.0µl, (d) Distilled water (18.377µl), (e) Enzyme Ex Taq (0.125µl)
Positive and negative test samples were run alongside the template DNA samples. The reaction mixture were run at the following conditions; denaturation at 94°C for 2 min.; thirty-five cycles of amplification at 95°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 30 seconds and the reaction was completed by a final 10 minutes extension at 72°C. Aliquots of amplification products were separated on 0.5% agarose gel in 0.5X Tris Borate Ethylene diamine tetra acetic acid (EDTA) buffer and visualized by ethidium bromide staining and UV transillumination
The antimicrobial susceptibility testing was done using the Kirby-Bauer disc diffusion method on Mueller Hinton Agar (Becton, Dickinson and Company, MD, USA) based on the Clinical Laboratory Standard Institute (CLSI) guidelines [27]. The antibiotic discs (Becton, Dickinson and Company, MD, USA) used included Nitrofurantoin (300µg), Cephoxitin (30µg), Kanamycin (30µg), Doxycycline (30 µg), Co-trimoxazole (1.25/23.75 µg), Amoxicillin and Clavulanic acid (AMC) (20µg/10µg), Tetracycline (30µg), Gentamycin (10µg), Chloramphenicol (30µg), and Oxacillin (1µg).

Figure2: Number of broiler carcasses contaminated with bacteria

Figure 2: PCR detection of Salmonella virulent gene invA, Lane 1 to 4. M, marker with 50 bp ladder, with amplicons being indicated by the arrow. Lane 1 and 2 being the negative and positive controls, respectively, Lane 3 and 4 are the Salmonella isolates of broiler carcasses #76 and #94.
Table 2: Antimicrobial sensitivity for Salmonella isolates from broiler carcasses

*Values obtained from the Clinical Laboratories Standards Institute (CLSI) Guidelines for Performance Standards for Antimicrobial Susceptibility Testing. 
 
RESULTS
a. Bacteria isolated from Broiler carcasses
A total of 100 swabs were collected from abattoir A and abattoir B, 50% coming from each site. The results of the study revealed that only 2 broiler carcasses were contaminated with Salmonella spp. Other bacteria that were isolated from the broiler carcasses included Escherichia coli (E. coli), Proteus spp, and Bacillus spp [table 1]. The most prevalent bacteria was E. coli which was isolated from 72 broiler carcasses, and it coexisted with other microorganisms such as Proteus spp, Salmonella spp and Bacillus spp [Table 1].
b. Molecular detection of Salmonella spp
The two Salmonella isolates that were subjected to PCR with primers that targeted the invA gene revealed amplicons with a band size of 284bp and were identified using gel electrophoresis [Figure 1]. This results therefore demonstrated the presence of invA gene in the Salmonella spp that was isolated from broiler carcasses.
c. Antibiotic sensitivity test of Salmonella enteritidis
The two Salmonella isolates were susceptible to Nitrofurantoin, Doxycycline, Co-trimoxazole, Amoxicillin and Clavulanic acid and Oxacillin. The isolates showed partial susceptibility to Cephoxitin, kanamycin and chloramphenicol. Resistance was observed on tetracycline and gentamicin.
DISCUSSION
From the study Salmonella was isolated from only 2 broiler carcasses (2%), the invA gene was detect from the isolates and they were resistant to tetracycline and gentamicin. In previous studies conducted in Lusaka District, the prevalence of Salmonella in broiler carcasses ranged from 20.53% to 46.15%, from 1998 to 2012, respectively [24, 28-29]. In a study by Hang’ombe et al (1998) a prevalence of 28% of Salmonella in processed broiler carcasses was reported, of which 16.82% was Salmonella enteritidis [28] and in another study the prevalence of Salmonella enteritidis was reported at 20.53% [29].The previous studies sampled both commercially and backyard processed broiler carcasses, therefore comparison of the prevalence is insignificant since the present study sampled commercially processed broiler carcasses only. The low prevalence of Salmonella in the study could be due to hygiene standards in commercial poultry abattoirs. Abattoirs in Lusaka adhere to strict Hazard Analysis Critical Control Point (HACCP) standards throughout the production process, thereby ensuring low microbiological contamination of broiler carcasses [30]. It was further reported that routine Salmonella surveillance activities are conducted by Department of Veterinary Services (DVS) through Central Veterinary Research Institute of Zambia (CVRI) to ensure high standards are upheld and poultry meat sold to public is free of Salmonella [31].
The invA gene which codes for proteins which are necessary for invasion of epithelial cells was present in the Salmonella isolated from commercially broiler carcasses. The isolation of invasive Salmonella serotypes from broiler carcasses in Lusaka district poses a public health risk as contaminated chicken serves as vehicle for transmission when consumed undercooked. Non-typhoidal salmonellosis (NTS) infections are clinically present as self-limiting gastroenteritis [32] but bacteraemia and other complications have been reported in sensitive populations (geriatrics, paediatrics, and immunocompromised individuals) [33, 34]. It is therefore important that poultry abattoirs produce broiler carcasses that are free of Salmonella.
Antibiotic sensitivity test results revealed that the Salmonella isolated from broiler carcasses were resistant to tetracycline and gentamicin. In study by Ulaya et al (2012), it was reported that Salmonella isolated from chickens showed higher resistance to tetracycline, gentamicin, vancomycin, erythromycin and co-trimoxazole [35]. Other bacteria isolated from poultry have also demonstrated multiple antibiotic resistance. In a study by Chishimba et al (2016), they reported high resistance rates of Escherichia coli isolated from poultry to ampicillin (100%), cefotaxime/ceftazidime (100%), tetracycline (59.7%), chloramphenicol (57.1%), and norfloxacin (54.5%) [36]. Tetracycline and gentamicin are extensively used in the poultry industry for treatment of a variety of diseases and also as growth promoters. The continued misuse of tetracycline and gentamicin in rearing of broilers has contributed to the development of resistant bacterial strains [37]. The resistance pattern observed with the Salmonella isolates in the study raises concern on the increasing antibiotics resistance of bacteria isolated from poultry.
CONCLUSION
The study confirmed a prevalence of 2% of a virulent multidrug resistant Salmonella spp in commercially processed broiler carcasses and this raises concerns on the public health risk to consumers of chickens. Furthermore, the study confirmed the resistance to tetracycline and gentamicin, which are commonly used antibiotics in poultry production.
RECOMMENDATIONS
The authors of the study therefore recommend that the Government of Republic of Zambia (GRZ) through the Zambia Medicines Regulatory Authority (ZAMRA) should institute controls on the indiscriminate purchase of antibiotics for livestock production. The on-counter purchase of antibiotics by poultry producers has led to the abuse of the drugs which are reportedly used in none bacterial infections and are often administered at lower doses than recommended. Furthermore, the authors propose the creation of an agency that will investigate the increasing trends of antibiotics resistance in both human and veterinary medicine.
The Department of Veterinary Services through the Central Veterinary Research Institute should continue with the routine Salmonella inspections to monitor the HACCP systems that are established in all the poultry abattoirs in Zambia.
List of References
1. Foley SL, Nayak R, Hanning IB, Johnson TJ, Han J, Ricke SC. Population dynamics of Salmonella enterica serotypes in
commercial egg and poultry production. Applied and Environmental Microbiology. 2011 Jul 1;77(13):4273-9.
2. Heyndrickx M, Vandekerchove D, Herman L, Rollier I, Grijspeerdt K, De Zutter L. Routes for Salmonella contamination of
poultry meat: epidemiological study from hatchery to slaughterhouse. Epidemiology and Infection. 2002 Oct;129(2):253-65.
3. Capita R, Alonso‐Calleja C, Prieto M. Prevalence of Salmonella enterica serovars and genovars from chicken carcasses in
slaughterhouses in Spain. Journal of Applied Microbiology. 2007 Nov 1; 103(5):1366-75.
4. Chotinun S, Rojanasthien S, Unger F, Tadee P, Patchanee P. prevalence and antimicrobial resistance of salmonella isolated
from carcasses, processing facilities and the environment surrounding small scale poultry slaughterhouses in Thailand.
Southeast Asian Journal of Tropical Medicine and Public Health. 2014 Nov 1; 45(6):1392.
5. Chotinun S. The status of hygienic practices of small-scale poultry slaughterhouse in Thailand: An ecohealth approach
(Doctoral dissertation, Chiang Mai University).
6. Chotinun S, Rojanasthien S, Unger F, Tadee P, Patchanee P. prevalence and antimicrobial resistance of salmonella isolated
from carcasses, processing facilities and the environment surrounding small scale poultry slaughterhouses in Thailand.
Southeast Asian Journal of Tropical Medicine and Public Health. 2014 Nov 1; 45(6):1392.
7. Rigby CE, Pettit JR. Changes in the Salmonella status of broiler chickens subjected to simulated shipping conditions.
Canadian Journal of Comparative Medicine. 1980 Oct;44(4):374.
8. Corry JE, Allen VM, Hudson WR, Breslin MF, Davies RH. Sources of Salmonella on broiler carcasses during transportation
and processing: modes of contamination and methods of control. Journal of Applied Microbiology. 2002 Mar 1;92(3):424-32.
9. Olsen EV, Pathirana ST, Samoylov AM, Barbaree JM, Chin BA, Neely WC, Vodyanoy V. Specific and selective biosensor for
Salmonella and its detection in the environment. Journal of Microbiological Methods. 2003 May 1;53(2):273-85.
10. Rasschaert G, Houf K, Godard C, Wildemauwe C, Pastuszczak-Frak M, De Zutter L. Contamination of carcasses with
Salmonella during poultry slaughter. Journal of Food Protection. 2008 Jan;71(1):146-52.
11. World Health Organization. Risk assessments of Salmonella in eggs and broiler chickens. Food & Agriculture Org.; 2002.
12. Luber P. Cross-contamination versus undercooking of poultry meat or eggs—which risks need to be managed first?.
International journal of food microbiology. 2009 Aug 31;134(1-2):21-8.
13. Schwarz S, Kehrenberg C, Walsh TR. Use of antimicrobial agents in veterinary medicine and food animal production.
International journal of antimicrobial agents. 2001 Jun 1;17(6):431-7.
14. Marshall BM, Levy SB. Food animals and antimicrobials: impacts on human health. Clinical microbiology reviews. 2011 Oct
1;24(4):718-33.
15. Foley SL, Lynne AM. Food animal-associated challenges: Pathogenicity and antimicrobial resistance. Journal of animal
science. 2008 Apr 1;86(14_suppl):E173-87.
16. Naik VK. Studies on Isolation and Molecular Characterization of Salmonella Spp. Of Public Health Significance in Chevron
and Chicken Meat (Doctoral dissertation, Chhattisgarh Kamdhenu Vishwavidyalaya, Durg (CG)
17. Marcus SL, Brumell JH, Pfeifer CG, Finlay BB. Salmonella pathogenicity islands: big virulence in small packages. Microbes
and Infection. 2000 Feb 29;2(2):145-56.
18. Hang ombe BM, Isogai E, Mubita C, Isogai N, Silungwe M, Chisenga C, Moonga L, Mulenga E, Yabe J, Takaya A, Yamamoto
T. Detection of invA, spiC, sipC, invF, and hilA in Salmonella isolated from beef and poultry by dot blot hybridization in Zambia.
International Journal of Applied Research in Veterinary Medicine. 2008 Jan 1;6(1):1.
19. Thong KL, Goh YL, Radu S, Noorzaleha S, Yasin R, Koh YT, Lim VK, Rusul G, Puthucheary SD. Genetic diversity of clinical
and environmental strains of Salmonella enterica serotype Weltevreden isolated in Malaysia. Journal of clinical microbiology.
2002 Jul 1;40(7):2498-503.
12
20. Jamshidi A, Kalidari GA, Hedayati M. Isolation and identification of Salmonella Enteritidis and Salmonella Typhimurium from
the eggs of retail stores in Mashhad, Iran using conventional culture method and multiplex PCR assay. Journal of food safety.
2010 Aug 1;30(3):558-68.
21. Malorny B, Hoorfar J, Bunge C, Helmuth R. Multicenter validation of the analytical accuracy of Salmonella PCR: towards an
international standard. Applied and environmental microbiology. 2003 Jan 1;69(1):290-6.
22. Foley SL, Johnson TJ, Ricke SC, Nayak R, Danzeisen J. Salmonella pathogenicity and host adaptation in chicken-associated
serovars. Microbiology and Molecular Biology Reviews. 2013 Dec 1;77(4):582-607.
23. Poultry Association of Zambia, Annual General Meeting Report, 2017
24. Munang’andu HM, Kabilika SH, Chibomba O, Munyeme M, Muuka GM. Bacteria isolations from broiler and layer chicks in
Zambia. Journal of pathogens. 2012 Sep 3;2012.
25. Bolder NM. Microbial challenges of poultry meat production. World’s Poultry Science Journal. 2007 Sep 1;63(03):401-11.
26. Northcutt JK, Berrang ME, Dickens JA, Fletcher DL, Cox NA. Effect of broiler age, feed withdrawal, and transportation on
levels of coliforms, Campylobacter, Escherichia coli and Salmonella on carcasses before and after immersion chilling. Poultry
Science. 2003 Jan 1;82(1):169-73.
27. Clinical and Laboratory Standards Institute, Performance Standards for Antimicrobial Susceptibility Testing, 19th Informational
Supplement M100-S19, Clinical and Laboratory Standards Institute, Wayne, Pa, USA, 2009.
28. Hang’ombe BM, Sharma RN, Skjerve E, Tuchili LM. Occurrence of Salmonella enteritidis in pooled table eggs and marketready
chicken carcasses in Zambia. Avian diseases. 1999 Jul 1:597-9.
29. Hang’ombe BM, Sharma NR, Skjerve E, Tuchili LM. Isolation of bacteria during processing of chicken carcasses for the
market in Lusaka, Zambia. Veterinarski arhiv. 1999 Sep 22;69(4):191-7.
30. Nyeleti C, Cogan TA, Kabilika SH, Katongo JC, Nyirenda S, Silomba S, Sinyangwe PG, Humphrey TJ. Antibiotic and
disinfectant resistance of Salmonella serovars isolated from the poultry production environment in Zambia. Bulletin of Animal
Health and Production in Africa. 2004;52(3):168-75.
31. Government of the Republic of Zambia. Department of Veterinary and Tsetse Control Services Annual Reports for the year,
2013. Lusaka: Government Printer, 2014.
32. Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O’brien SJ, Jones TF, Fazil A, Hoekstra RM. The global burden of
nontyphoidal Salmonella gastroenteritis. Clinical Infectious Diseases. 2010 Mar 15;50(6):882-9.
33. Salehi TZ, Mahzounieh M, Saeedzadeh A. Detection of invA gene in isolated Salmonella from broilers by PCR method. Int.
J. Poult. Sci. 2005;4(8):557-9.
34. Dhanoa A, Fatt QK. Non-typhoidal Salmonella bacteraemia: epidemiology, clinical characteristics and its’ association with
severe immunosuppression. Annals of clinical microbiology and antimicrobials. 2009 May 18;8(1):15.
35. Ulaya W, Hang BM. Distribution of virulence genes and antimicrobial susceptibility of Salmonella isolated from dogs and
chickens in Zambia. International Journal for Agro Veterinary and Medical Sciences. 2012;6(5):360-7.
36. Chishimba K, Hang’ombe BM, Muzandu K, Mshana SE, Matee MI, Nakajima C, Suzuki Y. Detection of extended-spectrum
beta-lactamase-producing Escherichia coli in market-ready chickens in Zambia. International journal of microbiology. 2016 Apr
17;2016.
37. Silbergeld EK, Graham J, Price LB. Industrial food animal production, antimicrobial resistance, and human health. Annu.
Rev. Public Health. 2008 Apr 21;29:151-69.