Category Archives: RESEARCH ARTICLES

Delayed referral for diagnostic endoscopy is a contributing factor to late gastric cancer diagnosis in Zambia

By: V Kayamba 1, 2, P Kelly 1,2, 3

1. Tropical Gastroenterology & Nutrition group, Department of Internal Medicine, PO Box 50398, Nationalist Road, Lusaka, Zambia.

2. University of Zambia School of Medicine, Department of Internal Medicine, PO Box 50110, Nationalist Road, Lusaka, Zambia.

3. Blizard Institute, Barts & The London School of Medicine and Dentistry, Queen Mary University of London, 4 Newark Street, London E1 2AT, UK.

Correspondence: Dr Violet Kayamba (viojole@yahoo.com)

DOWNLOAD PDF


Citation Style For This Article: Kayamba V,  Kelly P. Delayed referral for diagnostic endoscopy is a contributing factor to late gastric cancer diagnosis in Zambia. Health Press Zambia Bull. 2019;3(2); Pp 14-19


There is evidence that 15 % of gastric cancer patients in Zambia survive more than one-year after diagnosis. The major contributing factor to these poor outcomes is late case detection. We set out to investigate the time course of gastric cancer diagnosis in Zambia. The study was conducted at the University Teaching Hospital, in Lusaka. Consenting patients presenting to the endoscopy unit were enrolled and their endoscopic findings recorded. An interviewer-administered questionnaire was used to collect information on basic characteristics, presenting symptoms and duration. We enrolled 388 patients, 92 (24%) of whom had gastric cancer. About two-thirds of the gastric cancers were located in the distal part of the stomach. The median time to endoscopic gastric cancer diagnosis was 12 weeks, IQR 4-32 weeks after the first health care consultation. This was despite gastric cancer patients seeking healthcare attention within a median of 2 weeks, IQR 0-4 weeks of noticing the symptoms. Patients presenting with persistent vomiting or evidence of blood loss had significantly shorter delays than those with abdominal pain (p<0.05 and p<0.001 respectively). Delayed referral for diagnostic endoscopy is a contributing factor to late gastric cancer diagnosis in Zambia. The delay is highest in patients presenting with abdominal pain.

INTRODUCTION

Gastric cancer is a malignant tumour that can arise from any part of the stomach, including the cardia, fundus, body and antrum. It is the fifth most common cancer globally and the third leading cause of cancer related deaths. [1] Gastric cancer is commoner among men than women and the highest recorded incidence rates are from Korea, Mongolia and Japan. In Africa, data on gastric cancer are scarce mainly due to fragmented diagnostic facilities in these low resource countries. [2] There are very few African countries with reliable population-based registries region. [3] The Global Cancer Incidence, Mortality and Prevalence estimates the incidence of gastric cancer in Africa to be between 5.2 per 100,000 in some countries such as Angola to more than 20.2 per 100,000 in Mali. [1] In Zambia, gastric cancer is estimated to be the tenth among common cancers but this is similarly limited by challenges of case detection. Gastric cancer is the third most commonly diagnosed gastrointestinal cancer after oesophageal and liver cancers in the gastrointestinal unit at the University Teaching Hospital (UTH), unpublished observation.

The outcome of gastric cancer patients in Zambia is poor. We previously reported evidence that less than 15% of these patients live beyond one year after the initial diagnosis. [4] The advanced stage at which gastric cancer is diagnosed is one of the major contributors to the poor outcomes. Zambia has a referral system, in which patient’s first contact with healthcare is at primary care centres located in all districts of the country. Depending on the condition, the health care provider can then elect to refer them for secondary care offered at larger district and provincial hospitals. If specialist opinion is required, patients are then sent to tertiary institutions such as the UTH. Gastric cancer diagnosis can only be confirmed by examining a tissue sample obtained either endoscopically or during surgery, services that are not available in primary and most of the secondary care facilities. For a gastric cancer patient to be seen in a tertiary centre for confirmatory diagnosis, healthcare providers at the primary and secondary care levels have to promptly identify that such a patient needs urgent referral. This also depends on how quickly the patients present themselves at the health centres.

With the poor outcomes and delayed gastric cancer diagnoses observed at UTH, we endeavoured to analyse the time frames from the onset of symptoms to clinical diagnosis in order to establish the contributors to late diagnosis. The University of Zambia Biomedical Research Ethics committee, reference number 000-03-16, approved this study.

METHODS

Patient enrolment

The study was carried out between July 2016 and April 2018 at the University Teaching Hospital (UTH) gastroenterology unit. All consenting patients above the age 18 years coming in for upper gastrointestinal endoscopy were considered for enrolment. Excluded were those with history of ingesting a caustic substance or an obvious oesophageal or other extra gastric malignancy. Informed and written consent was obtained from all participating patients.

Study procedures

Upper gastrointestinal endoscopy was carried out on all patients following standard guidelines. Any lesions seen were recorded. After the procedure, an interviewer-administered questionnaire was used to collect information on the onset of symptoms and first healthcare consultation. In addition the data on basic characteristic were also collected.

Data analysis

Categorical and continuous variables were summarised using proportions, medians and interquartile ranges. Binary variables were compared using Fisher’s exact test and Kruskal-Wallis test was used to compare continuous variables. In all instances, a two-sided P value of <0.05 was considered statistically significant. Statistical analysis was done in STATA 15 (College Station, TX, USA).

RESULTS

Basic characteristics of patients stratified by endoscopic diagnosis

Table 1: Time from onset of symptoms to first consultation and endoscopic evaluation in patients stratified by endoscopic findings

Endoscopic findings

Normal

(n=186)

Cancer (n=92)

Other diagnoses*

(n=110)

P

Median (IQR)

Median (IQR)

Median (IQR)

Time to first consultation

0 (0-13) weeks

2 (0-4) weeks

1 (0-8) weeks

1.000

Time to endoscopic diagnosis

16 (4-104)

12 (4-32)

8 (3-52)

0.120

 

Figure 1: Anatomical location of gastric cancer as seen during upper gastrointestinal endoscopy

Figure 2 Presenting symptoms of patients with or without gastric tumours. Significance testing done with the Fisher’s exact test.

Figure 3: Time in weeks from onset of symptoms to diagnosis. Each horizontal line represents a gastric cancer patient. The x-axis shows time in weeks

Figure 4: Time to endoscopic diagnosis stratified by presenting symptoms. Significance tested using the Kruskal-Wallis test,* p-value<0.05, ***p-value<0.001

We enrolled 388 patients, 207 (53%) of whom were female with median age of 51 years (IQR 41-65 years). Gastric cancer was seen endoscopically in 92 (24%) patients. Of those without gastric cancer 110/296 (37%) had benign mucosal lesions including gastric or duodenal ulcers, gastric erosions, varices, polyps and other oesophageal lesions.

Anatomical location and clinical presentation of gastric cancer.

During the endoscopic procedures, the location of gastric cancer was recorded, and we found that 30% and 35% of the cancers were located in the antrum and body respectively. These are known as distal gastric cancers. The remaining 35 % were proximal cancers (Figure 1). The major presenting symptoms for of each the patients was then compared between gastric cancer patients and those without cancer. Gastric cancer patients were more likely to present with vomiting [OR 3.3, 95% CI 1.6-6.6; p=0.0005] or dysphagia [OR 9.9, 95% CI 2.8-43; p<0.0001] while those without cancer were more likely to present with abdominal pain [OR 0.5; 95% CI 0.3-0.9; p=0.01] (Figure 2).

Time in weeks from onset of symptoms to first consultation, then endoscopy for gastric cancer patients

Enrolled patients were asked about the time when their symptoms were first noticed and their first health care consultation. The median time from onset of symptoms to the first health care consultation was 2 weeks, IQR 0-4 weeks. It then took another median of 12 weeks, IQR 4-34 weeks for these patients to be sent for endoscopic diagnosis. The difference between these two time frames was statistically significant (p<0.0001). In Figure 3, the time to first consultation for each of the gastric cancer patients is shown in green, while the time to endoscopic diagnosis is shown in orange (Figure 3).

Time in weeks from onset of symptoms to first consultation, then endoscopy for all enrolled patients

The median time in weeks from onset of symptoms to first health care consultation was less than three weeks for all the patient groups. The time to endoscopic diagnosis was much longer with the highest median being 16 weeks for patients without mucosal lesions. The time to endoscopic diagnosis was highest in patients presenting with abdominal pain or anaemia and lowest among those with persistent vomiting or evidence of blood loss (Figure 4).

DISCUSSION

In this study, we present evidence that delayed gastric cancer diagnosis in Zambia is not just due to late patient presentation. Gastric cancer patients enrolled in this study did seek medical attention soon after noticing their symptoms but were not sent for diagnostic gastrointestinal endoscopy promptly.

The referral system in Zambia is designed to reduce patient burden in tertiary institutions by making primary and secondary health facilities available in centres close to the communities. It is therefore, incumbent upon the healthcare providers in these centres to identify patients in need of referral for specialised care. Similar to other African countries such as South Africa, Rwanda and Malawi, [5, 6, 7] gastric cancer patients in Zambia present with very advanced disease and can therefore only be offered palliate care. Another example is Nigeria where it was reported that only 30% of gastric cancer patients presented within a year of the symptom development. [8]

Late diagnosis is one of the major contributors to poor outcomes. Until now, reasons for late gastric cancer diagnosis in Zambia have just been speculative, mainly focussing on late patient presentation. Our data show that the median time from onset of symptoms to first contact with health care providers was not as long as the time it took for patients to be given the final diagnosis. This difference was statistically significant. Our data do not allow us to determine if healthcare providers fail to identify the need for endoscopy. Another contributing factor could have been the non-specific nature of gastric cancer symptoms. Gastric cancer is one of those cancers without very distinct symptoms. In very early stages of disease, it is virtually asymptomatic making detection difficult. When symptoms are present, they are non-specific: poor appetite, unintentional weight loss, abdominal pain with fullness or swelling, reflux symptoms, nausea, vomiting (with or without blood), melaena or anaemia. [9] A patient might have just one or two of these symptoms which could also be a manifestation of other diseases that do not necessarily require endoscopic evaluation. In addition, many of these symptoms become obvious in advanced disease. In a breast cancer study done in Zambia, authors concluded that one of the reasons for late diagnosis was ignorance about the existence of the disease. [10] This might also be true for gastric cancer as well.

We then endeavoured to identify which symptoms most likely to be associated with delayed presentation. The least delay was in patients with blood loss or persistent vomiting, suggesting that health care providers did identify these symptoms as suspicious for conditions requiring endoscopy. It should be noted that overt bleeding and persistent vomiting which could be a sign of luminal occlusion are late symptoms of gastric cancer. [11] The longest delay to diagnosis was in patients with abdominal pain. This is not surprising as abdominal pain is a very common symptom and is usually not indicative of gastric cancer. It can be due to many other diseases some of which are outside the gastrointestinal tract.

Such delays in diagnoses could contribute towards patients by-passing the set out referral system in preference for direct consultation at tertiary centres.  A study by Atkinson et al., showed that some patients in Zambia deliberately by-pass primary care centres and go directly to tertiary institutions. [12] There is some evidence that setting up screening camps for cancer diagnosis close to the communities could reduce diagnostic delays, [13] but the cost effectiveness for gastric cancer in Zambia has not be established. We recently published data in support of a non-invasive strategy that might be useful for early identification of patients with gastric cancer, but this is yet to be validated. [14]

This study has brought out information on gastric cancer diagnosis in Zambia that might be relevant to other cancers and medical conditions as well. Awareness of gastric cancer among health care workers needs to be increased. There is also need to conduct conduct more studies that will investigate particular reasons for each source of delay from onset of symptoms to final diagnosis and treatment.

CONCLUSION

Gastric cancer is diagnosed late in Zambia and this is not only due to late patient presentation. Patients presenting with abdominal pain have the longest delay.

ACKNOWLEDGEMENTS

We would like to acknowledge the three endoscopy nurses; Themba Banda, Rose Soko and Joyce Sibwani for their assistance rendered during all the endoscopic procedures.

FUNDING

Research reported in this publication was supported by the Fogarty International Center of the United States National Institutes of Health under Award number D43 TW009744. The content is solely the responsibility of the authors and does not necessarily represent the views of the National Institutes of Health.

List of References

1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin, 2018. 68(6): 394-424.

2. McFarlane G, Forman D, Sitas F, Lachlan G. A minimum estimate for the incidence of gastric cancer in Eastern Kenya. Br J Cancer. 2001. 85(9): 1322-5.

3. Laryea DO, Awuah B, Amoako YA, Osei-Bonsu E, Dogbe J, Larsen-Reindorf R, Ansong D, Yeboah-Awudzi K, Oppong JK, Konney TO, Boadu KO, Nguah SB, Titiloye NA, Frimpong NO, Awittor FK, Martin IK. Cancer incidence in Ghana, 2012: evidence from a population-based cancer registry. BMC Cancer. 2014.14: 362.

4. Asombang AW, Kayamba V, Turner-Moss E, Banda L, Trinkaus K, Colditz G, Mudenda V, Zulu R, Sinkala E, Kelly P. Gastric malignancy survival in Zambia, Southern Africa: A two year follow up study, Medical Journal of Zambia, 2014; 41, No. 1

5. Benamro F, Sartorius B, Clarke DL, Anderson F, Loots E, Olinger L. The spectrum of gastric cancer as seen in a large quaternary hospital in KwaZulu-Natal, South Africa. S Afr Med J. 2017 Jan 30;107(2):130-133.

6. Martin AN, Silverstein A, Ssebuufu R, Lule J, Mugenzi P, Fehr A, Mpunga T, Shulman LN, Park PH, Costas-Chavarri A. Impact of delayed care on surgical management of patients with gastric cancer in a low-resource setting. J Surg Oncol. 2018 Dec;118(8):1237-1242.

7. Kendig CE, Samuel JC, Tyson AF, Khoury AL, Boschini LP, Mabedi C, Cairns BA, Varela C, Shores CG, Charles AG. Cancer Treatment in Malawi: A Disease of Palliation. World J Oncol. 2013 Jun;4(3):142-146.

8. Osime OC, Momoh MI, Irowa OO, Obumse A. Gastric carcinoma–a big challenge in a poor economy. J Gastrointest Cancer. 2010 Jun;41(2):101-6.

9. American Cancer Society, signs and symptoms of gastric cancer. https://www.cancer.org/cancer/stomach-cancer/detection-diagnosis-staging/signs-symptoms.html, accessed on 10th January 2019.

10. McKenzie F, Zietsman A, Galukande M, Anele A, Adisa C, Parham G, Pinder L, Cubasch H, Joffe M, Kidaaga F, Lukande R, Offiah AU, Egejuru RO, Shibemba A, Schuz J, Anderson BO, Dos Santos Silva I, McCormack V. Drivers of advanced stage at breast cancer diagnosis in the multicountry African breast cancer – disparities in outcomes (ABC-DO) study. Int J Cancer. 2018 Apr 15;142(8):1568-1579.

11. National Cancer Institutes, Gastric cancer treatment. https://www.cancer.gov/types/stomach/patient/stomach-treatment-pdq, accessed on 11th January 2019.

12. Atkinson S, Ngwengwe A, Macwan’gi M, Ngulube TJ, Harpham T, O’Connell A. The referral process and urban health care in sub-Saharan Africa: the case of Lusaka, Zambia. Soc Sci Med. 1999 Jul;49(1):27-38.

13. Pinder LF, Nzayisenga JB, Shibemba A, Kusweje V, Chiboola H, Amuyunzu-Nyamongo M, Kapambwe S, Mwaba C, Lermontov P, Mumba C, Henry-Tillman R, Parham GP. Demonstration of an algorithm to overcome health system-related barriers to timely diagnosis of breast diseases in rural Zambia. PLoS One. 2018 May 10;13(5):e0196985.

14. Kayamba V, Zyambo K, Kelly P. Presence of blood in gastric juice: A sensitive marker for gastric cancer screening in a poor resource setting. PLoS One. 2018 Oct 15; 13(10):e0205185.

Facebooktwittergoogle_pluslinkedinmail

Anthrax Update (2018-2019)

By: B Gianetti1, BM Katemba1, A Moraes1, C Groeneveld1, KM Kanyanga1, R Hamoonga1, ML Mazaba1

1. Information Systems Unit, Zambia National Public Health Institute.

DOWNLOAD PDF


Citation Style For This Article: B Gianetti, BM Katemba, A Moraes, et.al. Anthrax Update (2018-2019). Health Press Zambia Bull. 2019 3(2); pp 8-13.


Anthrax is a zoonotic disease caused by the spore-forming bacteria Bacillus anthracis. Anthrax spores are resistant to extreme environmental pressures and are able to persist in the soil. Humans generally acquire anthrax by ingesting infected meat or handling infected animal carcasses and products.  People can develop three forms of anthrax infection dependent on the inoculation route: cutaneous, gastrointestinal, and pulmonary [1]. Cutaneous anthrax occurs when spores enter the body through a wound or opening in the skin and has a 20% mortality rate if left untreated. Gastrointestinal anthrax infection occurs when persons ingest contaminated food and has a mortality rate between 25 to 60%.  Pulmonary anthrax infection occurs when an individual inhales spores from the environment and has a mortality rate of greater than 80% [1].

Although several nations have made efforts to eliminate anthrax, infection still occurs in most sub-Saharan African countries. Anthrax is endemic in Zambia’s Luangwa valley and Zambezi floodplain [2–4]. Multiple anthrax outbreaks have been recorded in Zambia since 1990 due to the ingestion of contaminated beef and game meat, with case fatality rates (CFR) ranging from 4-20% [5–7].

In accordance with the Zambia Public Health Act (Chapter 295, Section 9), anthrax is a notifiable disease, and as such any suspected case requires a rapid Integrated Disease Surveillance and Response (IDSR) field investigation. Although reported anthrax cases have consistently decreased over the past 10 years, a recent outbreak of eight suspected cases in the Sesheke district of Western province prompted a review of reported anthrax cases in Western province from 2016-2019. This report presents an overview of the frequency and spatial distribution of suspected anthrax cases from January 2016 to January 2019.

Methods

We conducted a retrospective analysis of anthrax data collected using the IDSR system between January 2016 and January 2019 in order to identify trends in suspected anthrax cases in Zambia. Data was extracted from the weekly 2018 and 2019 IDSR reports as well as 2016 and 2017 outbreak investigation reports and analyzed using Microsoft Excel and Tableau.

The IDSR definition for a suspected cutaneous anthrax case is any person with an epidemiological link to confirmed or suspected animal cases or products who presents with a skin lesion that evolves over 1-6 days from a popular lesion to a vesicular lesion and ultimately to a black eschar accompanied by oedema. A suspected gastrointestinal anthrax case is any person with an epidemiological link to confirmed or suspected animal cases or products who presents with abdominal distress, characterised by nasusea, vomiting, anorexia, and fever. The suspected case definition for pulmonary anthrax is any person with an epidemiological link to confirmed or suspected animal cases or products who presents with symptoms resembling acute viral respiratory illness, followed by rapid onset of hypoxia, dyspnea, high temperature, and X-ray evidence of meditational widening.

Results

The majority of suspected anthrax cases occurred between July and December (Table 1). One hundred and twenty-seven suspected

Table 1. Suspected Anthrax cases 2016- 2019

anthrax cases were reported across Muchinga and Western provinces in 2016. Ninety cases were reported in Western province in 2017, and only four suspected anthrax cases were reported in Western province in 2018.  Samples for laboratory testing were collected from about 17% of reported suspected anthrax cases (Table 1).

An anthrax outbreak occurred in Muchinga district in September 2016 that consisted of 79 cases. The majority of suspected cases presented with cutaneous infection, were under 20 years of age, and reported having consumed hippopotamus meat (96%) [7]. Of the twelve samples collected from suspected anthrax cases, three samples tested positive for B. anthracis (Table 1, [7]).

Except for the 2016 outbreak in Muchinga province, all reported outbreaks between 2016 and 2019 occurred in Western province (Table 1).  Within Western province, four anthrax outbreaks were reported in 2016 and six in 2017.  Between November 2016 and February 2017 anthrax outbreaks resulted in 87 cases and 6 deaths in Shangombo, Nalolo, Kalabo, and Limulanga districts. In July 2017 a small outbreak consisting of two suspected anthrax cases occurred in Kalabo district, and from September to November 2017 anthrax outbreaks resulted in 49 suspected cases and two deaths in Nalolo, Sioma, Senanga, and Shangombo districts (Table 1, Figure 1).

The 2016/2017 outbreaks in Western province comprised 138 suspected anthrax cases and 8 deaths (CFR 5.8%).  Slightly more than 50% of all suspected cases were male, and almost half of all cases were between the ages of 5 and 19 years of age (44.9%) (Table 2). The majority of cases were reported in Kalabo and Shangombo districts (62.3%) (Table 2, Figure 1). One hundred and seventeen cases presented with cutaneous anthrax infection (84.8%), eleven cases had gastrointestinal anthrax (8.0%), and six cases presented with pulmonary anthrax (4.3%) (Table 2). Nearly all suspected anthrax cases received treatment (97.8%), most commonly at an outpatient health facility (88.4%). However, about three quarters (76.8%) of all suspected anthrax cases did not have a specimen collected for laboratory testing. Of the 28 specimens that were tested for B. anthracis, only 15 (53.6%) tested positive for anthrax infection (Table 2).

Figure 1. Map of suspected anthrax cases in Western province 2016 – 2019

 

Table 2. Characteristics of suspected anthrax cases in Western province 2016-2017

Table 3. Characteristics of anthrax deaths in Western province 2016-2017

 

Although the majority of cases reported during the 2016/2017 anthrax outbreaks in Western province were cutaneous infections, deaths due to anthrax occurred primarily amongst cases with gastrointestinal anthrax infections (62.5%) (Table 3).  Deaths were reported in Kalabo, Nalolo, Shangombo, and Sioma districts. Three of eight (37.5%) reported anthrax fatalities did not receive treatment, and of those who sought care, 62.5% were treated at an inpatient health facility (Table 3).

Four isolated suspected cases of anthrax occurred in Limulunga, Shangombo, and Senanga districts in Western province in 2018. Furthermore, a recent outbreak in Sesheke district in Western province in January 2019 amassed eight suspected anthrax cases (Table 1, Figure 1). Laboratory samples were not tested from any suspected case in 2018 and 2019 (Table 1).

Discussion

Between January 2016 and January of 2019 nine outbreaks and 265 suspected cases of anthrax were reported. During this period, one outbreak occurred in Chama district of Muchinga province and all other outbreaks occurred in Western province. In Western province, suspected anthrax cases were reported from Kalabo, Nalolo, Shangombo, Sioma, Senanga, Limulunga, and Sesheke districts.  The highest numbers of suspected cases were reported in Shangombo and Kalabo districts, and the majority of anthrax cases occurred between the months of July and December.  Over 80% of cases reported in Western province in 2016 and 2017 were cutaneous infections; however, 62.5% of anthrax fatalities were cases with gastrointestinal infections.

Traditionally, the majority of anthrax outbreaks in Zambia have occurred in Western province. A large outbreak occurred in Western province in 1990, during which 220 cases were documented. Between 1991 and 1998 a total of 248 cases and 19 deaths were reported across eight districts in Western and North-western provinces. Most cases consisted of gastrointestinal anthrax, although 33 cases presented with cutaneous anthrax infection [2]. Between 1999 and 2007 a total of 1,790 anthrax cases and 83 anthrax deaths were reported in the Kalabo, Lukulu, Mongu, Kaoma, Senanga, and Sesheke districts in Western province, and a small outbreak consisting of 3 cases of cutaneous anthrax was investigated in five villages in Sesheke district in 2010 [4,8].

Most outbreaks in Western province are associated with suboptimal vaccination of cattle and transmission to humans due to contact with infected animals and consumption of found animal carcasses [5,6]. As such, farming families and persons classified as food insecure have a high risk of contracting anthrax [9]. Historically, an increase of anthrax outbreaks in Zambia bas been observed between June and December, when the dry climate promotes increased human and livestock occupancy of the floodplain [4].

Alternatively, anthrax outbreaks in Muchinga province have been associated with the consumption of contaminated hippopotamus meat. The majority of anthrax cases reported during the 2016 Chama outbreak responded that they had eaten hippo meat. Moreover, an anthrax outbreak investigated in Chama district of Muchinga province in 2011 also found an association between anthrax infection and contact with and consumption of contaminated hippopotamus meat. Similar to the 2016 outbreak, a vast majority (95%) of cases presented with cutaneous anthrax [3].

Regardless of the location of an anthrax outbreak or the type of anthrax infection, less than 20% of suspected anthrax cases had specimens collected for laboratory diagnosis.  Of the samples that were tested from cases during the 2016 and 2017 Western province anthrax outbreaks, 46.4% tested negative for a Bacillus anthracis infection.  However, nearly all suspected cases received treatment for anthrax. Collection of samples from suspected animal and human infections is required to improve anthrax surveillance and help monitor the potential development of antimicrobial resistance in endemic Bacillus anthracis strains[10].

Conclusions and recommendations

Previous efforts to control anthrax outbreaks in endemic regions include mass vaccination of livestock, quarantine of infected animals, burning or burying of animal carcasses, and sensitization of the community [5]. Despite these measures, the close proximity of people and animals and food insecurity in the region continue to drive anthrax transmission [8,11,12]. While most people are aware of the threat of anthrax, entrenched behaviors and cultural practices are difficult to change. Continued outbreaks in Western province highlight the importance of increasing community sensitization and health education campaigns in the area. Moving forward, a well-coordinated One Health approach is required to prevent animal and human anthrax infections in endemic regions of Zambia.

List of References

1. Types of Anthrax | Anthrax | CDC [Internet]. 2019 [cited 2019 Feb 26];Available from: https://www.cdc.gov/anthrax/basics/types/index.html

2. Siamudaala VM, Bwalya JM, Munang’andu HM, Munag’andu HM, Sinyangwe PG, Banda F, et al. Ecology and epidemiology of anthrax in cattle and humans in Zambia. Jpn. J. Vet. Res. 2006;54:15–23.

3. Hang’ombe MB, Mwansa JCL, Muwowo S, Mulenga P, Kapina M, Musenga E, et al. Human-animal anthrax outbreak in the Luangwa valley of Zambia in 2011. Trop. Doct. 2012;42:136–9.

4. Munang’andu HM, Banda F, Siamudaala VM, Munyeme M, Kasanga CJ, Hamududu B. The effect of seasonal variation on anthrax epidemiology in the upper Zambezi floodplain of western Zambia. J. Vet. Sci. 2012;13:293–8.

5. Moraes A. Recovering from an Anthrax epidemic: What are the control strategy challenges and policy options? Health Press Zamb. Bull 2017;1:63–6.

6. N Kasese-Chanda, Mulubwe B, Mwale F. Outbreak of Anthrax among humans and cattle in Western province of Zambia, November 2016 to January 2017. Health Press Zamb. Bull 2017;1:50–5.

7. Mwambi P, Mufunda J, Mwaba P, Kasese-Chanda N, Mumba C, Kalumbi T, et al. Cutaneous Anthrax outbreak in Chama District, Muchinga province, Zambia, 2016 as history repeats itself. Health Press Zamb. Bull 2017;1:38–49.

8. Munang’andu HM, Banda F, Chikampa W, Mutoloki S, Syakalima M, Munyeme M. Risk analysis of an anthrax outbreak in cattle and humans of Sesheke district of Western Zambia. Acta Trop. 2012;124:162–5.

9. Sitali DC, Mumba C, Skjerve E, Mweemba O, Kabonesa C, Mwinyi MO, et al. Awareness and attitudes towards anthrax and meat consumption practices among affected communities in Zambia: A mixed methods approach. PLoS Negl. Trop. Dis. 2017;11:e0005580.

10. Ågren J, Finn M, Bengtsson B, Segerman B. Microevolution during an Anthrax outbreak leading to clonal heterogeneity and penicillin resistance. PloS One 2014;9:e89112.

11. Lehman MW, Craig AS, Malama C, Kapina-Kany’anga M, Malenga P, Munsaka F, et al. Role of Food Insecurity in Outbreak of Anthrax Infections among Humans and Hippopotamuses Living in a Game Reserve Area, Rural Zambia. Emerg. Infect. Dis. 2017;23:1471–7.

12. Sitali DC, Twambo MC, Chisoni M, Bwalya MJ, Munyeme M. Lay perceptions, beliefs and practices linked to the persistence of anthrax outbreaks in cattle in the Western Province of Zambia. Onderstepoort J. Vet. Res. 2018;85:e1–8.

 

 

 

Facebooktwittergoogle_pluslinkedinmail

Cluster Survey Evaluation of Reasons of Vaccination Failure in Measles-Rubella Vaccination Campaign in Zambia, 2016

M Silitongo1, ML Mazaba2, D Mulenga3, M Chirambo-Kalolekesha1, EM Njunju1, V Daka3, W Tinago4, E Rudatsikira 5, PM Syapiila 3, C Banda 3, T Marufu6, S Siziya7

1. Department of Basic Sciences, Michael Chilufya Sata School of Medicine, Copperbelt University, Ndola, Zambia

2. The Health Press, Zambia National Public Health Institute, Ministry of Health, Lusaka, Zambia

3. Department of Clinical Sciences, Public Health Unit, Michael Chilufya Sata School of Medicine, Copperbelt University, Ndola, Zambia

4. School of Medicine and Medical Science, University College Dublin, Dublin, Ireland

5. Department of Public Health, Nutrition and wellness, School of Health Professionals, Andrews University, Berrien Springs, Michigan, USA

6. Department of Community Medicine, College of Health Sciences, University of Zimbabwe, Harare, Zimbabwe

7. Dean’s Office, Michael Chilufya Sata School of Medicine, Copperbelt University, Ndola, Zambia

Download PDF


Citation Style For This Article: Silitongo M, Mazaba Ml, Mulenga D, et.al. Cluster Survey Evaluation of Reasons of Vaccination Failure in Measles-Rubella Vaccination Campaign in Zambia, 2016. Health Press Zambia Bull. 2019;3(1); Pp 21-26.


Abstract

A pool of susceptible children to measles and rubella (MR) may increase partly due to non-vaccination of children and as a result lead to MR epidemics. The objective of this study was to establish reasons for non-vaccination in 2016 Measles-Rubella campaign in Zambia. A country-wide cross sectional study was conducted among children aged 9 months to 14 years of age. A total of 6,490 children participated in the survey with a response rate of 87.3%. The following were the common reasons for non-vaccination of children: Central province (56.8% stated that vaccine was not available); Copperbelt (26.3% reported family problems including illness of mother/care taker); Eastern (26.6% indicated that time for session was inconvenient); Luapula (23.8% were unaware of the need for vaccination); Lusaka (24.9% indicated fear of side effects); Muchinga (22.4% stated that mother/caretaker was too busy); Northern (17.0% reported that mother/caretaker was too busy); North-western (38.1% indicated that the vaccine was not available); Southern (53.0% reported that the vaccine was not available) and Western (26.4% were unaware of the need for vaccination) and National (23.5% indicated that the vaccine was not available). There is need to increase coverage in the distribution of MR vaccine to ensure that all children receive the vaccine. Health education and promotion activities must be conducted in communities to ensure that the concept of immunization is well received so that deliberate efforts will be applied to ensure that children are vaccinated..

Keywords: Measles, Rubella, reasons for non-vaccination, Zambia.

Introduction

Measles and Rubella are highly contagious viral infections [1,2]. Measles is caused by an enveloped ribonucleic acid (RNA) virus of the Morbillivirus genus in the family Paramyxoviridae [2,3] and is characterised by fever cough, running nose conjunctivitis and characteristic erythematous and maculopapular rash [3-5]. Meanwhile, rubella is caused by a single-stranded ribonucleic acid virus of the Togaviridae family and is the only member of the genus Rubivirus. The disease causes mild symptoms in children and adults whilst causing abortions, miscarriages and congenital rubella syndrome [6]. Despite both diseases causing morbidity and mortality in developing countries, they are both vaccine preventable diseases [5]. Developed countries have managed to control and eradicate these diseases by implementing measures such as giving a first dose of MMR at age 12-15 months, giving a second dose of MMR to school-age going children and vaccinating high-risk groups such as infants aged 6 to 11 months [7]. In an effort to control measles and rubella, developing countries have conducted vaccination campaigns [2,8-11]. Strategies implemented in Cuba included vaccinating men and women of childbearing age and developing integrated measles and rubella surveillance systems [12].

The Expanded Programme on Immunization in Zambia is one of the health priorities in addressing and reducing vaccine preventable diseases such as pneumonia, diarrhoea and measles, which have been the leading causes of death in children under the age of five years. The National Immunisation Programme introduced a number of new and underused vaccines between 2004 till 2013 starting with the tetravalent: DTP+Hib and switching to pentavalent DPT-HepB+Hib in 2005. Measles containing vaccine second dose (MCV2) and Pneumonia Conjugate Vaccine (PCV10) were introduced in the national immunisation programme in July 2013 while Rotavirus and Human Papilloma Vaccine (HPV) vaccines were introduced in Lusaka province as a demo project in 2012 and 2013 respectively and there was a Rota vaccine national roll-out was in November 2013. Following documentation of Congenital Rubella Syndrome and the measles case based surveillance, the results of which have shown that up to 30% of suspected measles cases tested positive for Rubella, justification for the introduction of rubella vaccine.

Zambia conducted two under 15 years integrated measles supplemental immunisation campaigns between 2003 and 2012. The measles-only supplemental immunisation activities (SIAs) offered a second opportunity for vaccination against measles through a mass vaccination campaign. Additionally, the country conducted countrywide follow-up mass measles vaccinations in 2007 and 2010, and a measles-rubella SIA was conducted in September 2016. The introduction of the measles-rubella combined vaccine and a two dose vaccination schedule is important in maintaining adequate vaccination coverage and keeping antibody levels against measles and rubella sufficiently high [1,11]. Failure to be vaccinated contributes to increasing a pool of susceptible children that may lead to epidemics. The objective of this study was to establish reasons for non-vaccination in 2016 Measles-Rubella campaign in Zambia.

Methods

Study area

A study was conducted in all 10 provinces of Zambia (Central, Copperbelt, Eastern, Luapula, Lusaka, Muchinga, Northern, North Western, Southern and Western). Zambia shares borders with the following countries: Malawi and Mozambique in the east, Democratic Republic of Congo and Tanzania in the north, Angola in the west, and Zimbabwe and Namibia in the south (Figure 1). The 10 province are further subdivide into districts, constituencies and wards. In 2010, there were 74 districts, 150 constituencies and 1,430 wards [13]. The number of districts in Zambia has since been increasing.

Zambia has a population of 13,092,666 with a population density of 17.4 persons per square kilometer [13]. About half (50.7%) of the population is male. Zambia has a young population with 45.4% of its population aged below 15 years. Officially, children start schooling at the age of seven years. They would be of age 7-13 years in Grades 1-7 (primary education) and 14 or 15 years in Grades 8 or 9 (lower secondary education). The overall net primary school attendance rate is 71.6% (72.2% of females and 70.9% of males; 79.6% in urban and 66.9% in rural areas). The under-five mortality rate stood at 75 deaths per 1000 live births in 2013/14 [14].

Study design, target population, sample size and sampling.

A cross sectional study was conducted among children aged 9 to 179 months. The required sample size for the number of clusters was determined using a method proposed by the World Health Organization [15] and considering a desired precision of +5%, expected immunization coverage of 95%, effective sample size of 162 in each province, a design effect for each province varied from 1.04 to 2.29 and a 10 percent non response rate. The required sample size of 228 clusters was obtained, giving 2736 households (12 households in each cluster).

A two-stage cluster sampling method was used to draw the sample. At the first sampling stage, the sampled Standard Enumeration Area(s) (SEAs) were selected within the provinces systematically with probability proportional to size (PPS) from the ordered list of SEAs on the census 2010 sampling frame. The measure of size for each (Enumeration Area) EA was based on the household size identified in the 2010 Census [13]. In order to ensure representation from the whole target area, the frame was sorted by district, constituency, ward, rural/urban, (Census Supervisory Area (CSA) and SEA. A systematic random sampling method was used to select households in the second stage of sampling.

Training and data quality

Training of research assistants was facilitated by national supervisors, statistician and local consultant. External Consultants from WHO IST AFRO and UNICEF ESARO provided technical support during training in addition to quality control during field work. The questionnaire was interviewer administered to the respondents. Data quality team consisting of WHO, UNICEF, MoH and the local consultant visited the survey teams in the field to check on the work conducted and the quality of data. During the visit, the team reviewed the completed questionnaires with the supervisors and interviewing teams for any errors or missing information and corrective measures were immediately taken. The quality control team ensured that they observed the process of one household being interviewed from the beginning to the end of the interview as means of verifying adherence to survey protocol.

Data Management and analysis

Household data were computerized using the Coverage Survey Analysis System (WIN-COSAS) software.  Double entry was done on all data sets to control for and correct any entry errors. Data analysis was conducted using SPSS. All analyses were weighted to adjust for varying response rates according to proportions of clusters and households that were selected in the stratum.

Table 1. Household response rates at provincial and national levels

 

Province

 

Sampled Clusters

Clusters Interviewed Number of households Household Response rate (%)
Sampled Interviewed
Central 30 30 360 317 88.1
Copperbelt 18 17 216 163 75.5
Eastern 18 18 216 216 100.0
Luapula 26 24 312 288 92.3
Lusaka 24 24 288 250 86.8
Muchinga 18 18 216 206 95.4
Northern 26 26 312 270 86.5
North western 14 14 168 154 91.7
Southern 26 26 312 237 76.0
Western 28 27 336 288 85.7
National 228 224 2,736 2,389 87.3

Results

Totals of 2,389 households and 6,490 children were enrolled into the survey.  Table 1 shows response rate at provincial and national levels.  Response rates of above 85% were achieved in all the provinces except Copperbelt (75.5%) and Southern (76.0%) province. The national response rate was recorded at 87.3%. Overall, 5.0% (5.5% of males and 4.6% of females) of children were not vaccinated.

Reasons for non-vaccination of children are shown in Table 2.  Overall, in all the provinces except Lusaka and Western provinces, obstacles were the main reasons for non-vaccination of children.  In Lusaka province, the main reason for non-vaccination of children was fear of side reaction (24.9%). Meanwhile, in Western province the main reasons for non-vaccination was luck of availability of the vaccine (23.6%) and  unawareness of the  need for immunization (26.4%).  Specifically, the following were the common reasons for non-vaccination of children: Central province (56.8% stated that vaccine was not available); Copperbelt (26.3% stated family problems including illness of mother/care taker); Eastern (26.6% indicated that time for session was inconvenient and 20.4% were unaware of the need for vaccination); Luapula (23.8% were unaware of the need for vaccination); Lusaka (24.9% indicated fear of side effects); Muchinga (22.4% stated that mother/caretaker was too busy); Northern (17.0% reported that mother/caretaker was too busy and 16.5% decided to postpone until another time); North-western (38.1% indicated that the vaccine was not available and 19.4% said that the health worker was absent); Southern (53.0% said that the vaccine was not available) and Western (26.4% were unaware of the need for vaccination while 23.6% said the vaccine was not available).  Nationally, 23.5% said that the vaccine was not available while 13.0% were unaware of the need for immunization.

Source: https://zambiareports.com/wp-content/uploads/2015/11/Zambian-Map.jpg

Figure 1: Map of Zambia showing its provinces and neighbouring countries

 

 

Table 1: Reasons for child not being vaccinated by province in percentages

Reason for non-vaccination  

Central

 

Copperbelt

 

Eastern

 

Luapula

 

Lusaka

 

Muchinga

 

Northern

North- Western  

Southern

 

Western

 

National

Vaccine not available 56.8 2.8 0.5 14.3 1.0 11.2 2.5 38.1 53.0 23.6 23.5
Unaware of need for immunization 11.1 3.0 20.4 23.8 11.6 1.3 8.0 0.0 1.9 26.4 13.0
Unaware of time for session 1.5 11.0 7.2 11.8 16.3 1.8 3.5 6.0 1.4 7.2 7.9
Mother/care taker to busy 1.1 5.5 11.8 9.7 3.3 22.4 17.0 10.3 0.5 2.5 7.1
Time of session inconvenient 0.8 7.7 26.6 11.4 9.5 3.5 1.0 2.6 0.0 2.7 6.9
Decided to post pone until another time 2.2 4.2 7.6 6.7 7.3 12.9 16.5 1.2 0.0 4.7 5.5
Fear of side reactions 0.6 5.3 0.0 0.3 24.9 0.0 3.4 1.5 0.3 6.9 5.1
Family problem including illness of mother/care taker 0.0 26.3 7.9 3.0 1.1 0.0 9.5 7.2 6.4 8.8 4.8
Place of session too far 7.4 6.1 3.3 6.4 0.3 0.0 1.0 1.2 4.1 3.8 3.8
Health worker absent 0.0 4.3 1.9 0.0 0.0 0.0 9.4 19.4 1.8 0.5 3.8
Child ill, not brought 0.4 7.4 1.7 0.9 1.6 2.2 4.7 2.6 0.9 1.3 1.7
Place of immunisation unknown 0.4 0.0 0.0 0.0 4.8 0.0 3.2 0.0 5.8 0.0 1.5
Wrong ideas about contra-indications 2.9 0.0 0.0 0.4 1.9 3.3 5.5 0.3 0.0 2.6 1.5
No faith immunisation 0.0 0.0 0.0 0.0 5.8 0.0 0.0 0.0 0.0 8.0 1.4
Religious reasons 1.5 0.0 0.0 0.8 1.5 0.0 0.0 0.0 0.5 0.0 0.7
Rumours 0.0 4.5 5.0 0.0 0.3 2.7 0.0 0.0 0.0 0.0 0.5
Long waiting time 0.0 1.5 1.2 0.0 0.0 0.0 3.4 0.0 0.0 0.0 0.4
Child ill brought but not given immunisation 0.0 0.0 0.5 0.0 0.3 0.0 0.0 0.0 0.0 0.0 0.1
Other 13.3 10.1 4.4 10.6 8.6 38.7 11.4 9.6 18.8 1.0 10.6

Discussion

This study investigated the causes of non-vaccination in the 2016 Measles/Rubella vaccination campaign. The main reason for non-vaccination in five of Zambia’s ten provinces was unavailability of vaccine. On the Copperbelt province, the main reason for non-vaccination was family problem including illness of mother/care taker whilst in Lusaka province it was the fear of side reactions. Inconvenient time of vaccination session and mother or caretaker being too busy were the main reasons in the Eastern and Northern provinces respectively. Lack of enough coverage during vaccination has also been cited as a cause of non-vaccination and Measles/Rubella outbreaks [2,16]. The 2010 – 2011 Measles outbreaks in Zambia were attributed to low routine immunisation coverage [17]. In Mozambique, some measles outbreaks have been associated with insufficient vaccine coverage to interrupt measles transmission [18]. In Nigeria where there is perennial, low routine vaccination coverage and where the quality of the mass immunization campaign is not high enough, large and persistent measles outbreaks continue to occur with high morbidity and mortality [19,20].

In Haiti, Tohme et al [16] reported 31% of non-vaccination being due to caregivers not being aware of the vaccination exercise. This was one of the main reasons for measles-rubella non-vaccination in Luapula, Eastern and Western provinces of Zambia. At national level in Zambia, the main reason for non-vaccination was unavailability of vaccine unlike in Haiti where vaccine unavailability was not among the main reasons. World Health Organisation (WHO) Global Burden of Disease (GBD) project indicate that approximately 1.7 million vaccine-preventable childhood deaths occurred in 2000, of which 46% were attributed to measles. The measles deaths occurred overwhelmingly among children living in poor countries with inadequate vaccination services [21]. Failure to control measles has usually been due to a failure to implement planned strategies adequately [22]. For complete elimination of Measles there is the need to raise the visibility of measles elimination and make adequate investments in strengthening health systems [2,23]. Sartorious et al [2] suggested that identifying and targeting emerging high-risk areas in resource-limited settings where vaccine coverage is low or waning appears a more viable strategy for preventing outbreaks in sub-Saharan.

Conclusion

The control and eventual eradication of measles and rubella partly hinge on the ability to vaccinate all children to avoid pool of susceptible children to increase that could lead to epidemics. There is need to increase coverage in the distribution of MR vaccine to ensure that all children receive the vaccine. Health education and promotion activities must be conducted in communities to ensure that the concept of immunization is well received so that deliberate efforts will be applied to ensure that children are vaccinated.

List of References 

1.  Takayama N. Measles and rubella. Rinsho Byori 2005;53:845-52.

2.   Sartorius B, Cohen C, Chirwa T, Ntshoe G, Puren A, Hofmana K. Identifying high-risk areas for sporadic measles outbreaks: lessons from South Africa. Bull World Health Organ 2013;91:174-183.

3.  WHO. Immunization, vaccines and biological: The immunological basis for immunization series: Module 7: Measles. Update 2009. Geneva, Switzerland: World Health Organization, 2009.

4.    Permar SR, Moss WJ, Ryon JJ, Monze M, Cutts F, Quinn TC, et al. Prolonged measles virus shedding in human immunodeficiency virus–infected children, detected by reverse transcriptase – polymerase chain reaction. J Infect Dis 2001;183:532–8.

5.   Moss WJ, Griffin DE. Global measles elimination. Nat Rev Microbiol 2006;4:900-8.

6. Zuckerman AJ,  Banatvala JE,  Pattison JR,  Griffiths PD, Schoub BD. Principles and practice of clinical virology, 5th Edition. John Wiley & Sons, Ltd,  2004.

7. Otten M, Kezaala R, Fall A, Masresha B, Martin R, Cairns L, et al. Public-health impact of accelerated measles control in the WHO African Region 2000-03. Lancet 2005;366:832–9.

8. WHO, UNICEF. Measles: mortality reduction and regional elimination strategic plan 2001–2005. Geneva: World Health Organization & United Nations Children’s Fund, New York; 2001.

9. Centers for Disease Control and Prevention (CDC). Progress toward measles elimination–Southern Africa, 1996–1998. MMWR Morb Mortal Wkly Rep 1999;48(27):585-9.

10.    Manakongtreecheep K, Davis R. A review of measles control in Kenya, with focus on recent innovations. Pan Afr Med J. 2017;27(Suppl3):15.

11. Pan American Health Organization Division of Vaccines and Immunization. Final report. Conclusions and recommendations. 14th meeting of the Technical Advisory Group on Vaccine Preventable Diseases. Brazil: PAHO; 2001.

12. Central Statistical Office [Zambia]. 2010 Census of population and housing: national analytical report. CSO, Lusaka, 2012.

13. Central Statistical Office (CSO) [Zambia], Ministry of Health (MOH) [Zambia], and ICF International. Zambia Demographic and Health Survey 2013-14. Rockville, Maryland, USA: Central Statistical Office, Ministry of Health, and ICF International, 2014.

14. WHO. Vaccination coverage cluster survey: Reference manual Annexes, July 2015. Accessed 2018 July 15. URL: http://www.who.int/immunization/monitoring_surveillance/Vaccination_coverage_cluster_survey_with_annexes.pdf.

15. Tohme RA, François J, Wannemuehler K, Magloire R, Danovaro-Holliday MC, Flannery B, et al. Measles and rubella vaccination coverage in Haiti, 2012: progress towards verifying and challenges to maintaining measles and rubella elimination. Trop Med Int Health. 2014;19:1105-15.

16.  Mpabalwani ME, Matapo B, Katepa-Bwalya N, Mukonka V, Mutambo H, Babaniyi OA. The 2010-2011 measles outbreak in Zambia: Challenges and lessons learnt for future action. East Afr J Public Health 2013;10:265–73.

17. Muloliwa AM, Camacho LAB, Verani JFS, Simões TC, Dgedge MC. Impact of vaccination on the incidence of measles in Mozambique in the period 2000 to 2011. Cad Saúde Pública (Rio de Janeiro) 2013;29:257-69.

18. Okonko O, Nkang AO, Udeze AO, Adedeji AO, Ejembi J, Onoja BA, et al. Global eradication of measles: a highly contagious and vaccine preventable disease-What went wrong in Africa? J Cell Animal Biol 2009;3(8):119-40.

19. Salako AA, Sholeye OO. Control of measles in Nigeria: A critical review of the literature. Br J Med Med Res 2015;5:160-8.

20. Centers for Disease Control and Prevention (CDC). Update: global measles control and mortality reduction–worldwide, 1991-2001. MMWR Morb Mortal Wkly Rep. 2003;52:471-5.

21. Cutts FT, Markowitz LE. Successes and failures in measles control. J Infect Dis. 1994;170(Suppl 1):S32-41.

22. Perry RT, Gacic-Dobo M, Dabbagh A, Mulders MN, Strebel PM, Okwo-Bele JM, et al. Global control and regional elimination of measles, 2000–2012. MMWR Morb Mortal Wkly Rep. 2014;63:103-7.

 

Facebooktwittergoogle_pluslinkedinmail

A retrospective analysis of measles trends and vaccination coverage in Zambia from 2016 to 2018

Contributors: Brave maxwell katemba, Brittany Gianetti, Chanda Groeneveld, Dien Mwansa Kaluba Musakanya, Brivine sikapande Josephine Simwinga,Raymond Hamoonga, Mazyanga Lucy Mazaba

1. information systems unit Zambia National public health institute

Download PDF


Citation style for this article: Katemba BM, Gianetti B, Groeneveld C, et al. A retrospective analysis of measles trends and vaccination coverage in Zambia from 2016 to 2018. Health Press Zambia Bull. 2019;3(1); pp 1-2.


Introduction

Measles is a highly contagious infection caused by the measles virus (MeV). The MeV is transmitted from person-to-person via respiratory droplets or aerosolized small particles suspended in the air as a result of sneezing or coughing. On average, a single measles case infects 9-18 people (Ro= 9-18); in comparison, a person infected with influenza only infects 2-3 people (Ro= 2-3)1.

Prior to the introduction of the measles vaccine in the 1960s, measles was a leading cause of childhood mortality, accounting for 2 million deaths globally each year.  The number of measles deaths decreased drastically due to the initiation of the Expanded Program on Immunization in 1974 and subsequent increase in global measles vaccination coverage2. Approximately 110,000 measles deaths were reported in 2017.

The World Health Organization (WHO) recommends that a child receive the first dose of measles containing vaccine (MCV1) at 9 months. However, MCV1 can be administered at 6 months if the infant lives in an area experiencing a measles outbreak, is classified as an internally displaced person or a refugee, or is born with HIV.  The measles containing vaccine (MCV) is 85% effective in children vaccinated at 9 months. In countries that schedule MCV1 at 9 months, a second dose of MCV (MCV2) is recommended at 15-18 months. The estimated 2015 global coverage for MCV1 and MCV2 was 85% and 61%, respectively1.

In the 1990s measles immunisation coverage in Zambia was less than 70%, and measles outbreaks occurred on a yearly basis3. In 1991 Zambia reported 1,698 cases of measles, and in 1999 the number rose to 23,518 measles cases. During the 1999 measles outbreak the mortality rate in hospitalized children was 13.7%3. In response, Zambia launched supplemental immunisation activities (SIAs) targeting children between 9 months and 4 years of age to increase immunity in the under five population4. Zambia continued its routine MCV immunisation program and performed additional MCV SIAs in 2000, 2003, 2007, and 20103,4. Despite the incorporation of MCV SIAs, Zambia experienced a measles outbreak in 2010/2011 that resulted in 35,572 cases and 242 deaths (Case Fatality Rate: 0.64%)3,5.

In September 2018, Zambia launched a national immunsation campaign using a combined measles and rubella vaccine targeting all children between the ages of 9 months and 15 years. The routine childhood immunisation schedule in Zambia recommends administration of MCV1 at 9 months and MCV2 at 18 months. In 2015, the Zambian MCV1 and MCV2 coverage estimates were 90% and 47%, respectively6. Currently, Zambia seeks to achieve 95% child MCV coverage each year through its routine immunization program.

The number of measles cases and deaths due to measles in Zambia has been steadily declining over the past decade.  In order to determine the trends in measles cases in Zambia during the past few years, we analyzed national surveillance and immunisation data from 2016-2018.

Methods

To identify weekly trends in measles cases in Zambia, we conducted a retrospective analysis of measles data collected using the Integrated Disease Surveillance and Response (IDSR) system between 2016 and 2018. Data was extracted from the weekly 2016, 2017 and 2018 IDSR reports and analyzed using Microsoft Excel and STATA 13. To determine national MCV1 and MCV2 immunisation coverage from 2016-2018, we accessed childhood immunisation data reported in the Zambian Health Management Information Systems (HMIS). Vaccination coverage was calculated by dividing the reported annual number of MCV1 and MCV2 doses administered by the estimated number of children <1 year (MCV1) and <2 year (MCV2), as determined by projected census data adjusted for annual population growth. All surveillance data used in this paper were generated within the IDSR framework of Zambia and represents the national picture of reported measles cases.

Results

The IDSR definition of a suspected measles case is: any person with fever and maculopapular generalized rash and cough, coryza or conjunctivitis, or any person in whom a clinician suspects measles. Using the IDSR definition, Zambia reported a total of  688 in 2016, 606 in 2017 and 558 suspected measles cases in 2018 (Table 1).

In 2018, a spike in the number of suspected measles cases occurred on epidemiological week 17, during which 35 suspected cases were reported in North-western province (Figure 1 & Figure 2). Twenty suspected measles cases were reported in Luapula province in epidemiological week 30 (Figure 2). During this period, from July 5th to July 30th 2018, 24 suspected measles cases were reported in six districts in Luapula province (Mansa, Mwense, Mwansabombwe, Nchelenge, Lunga and Samfya). Sixteen patients

Figure 1: Reported suspected measles cases in Zambia 2016-2018

Figure 2: Trends in suspected measles cases by province (2018)

were treated for measles and discharged from health facilities, and one fatality was reported in the community. In response, a field investigation was undertaken in the affected districts. Blood samples from all 24 suspected measles cases were sent to the virology laboratory at University Teaching Hospital (UTH) for laboratory confirmation, and four measle cases from the Paul-Mambilima Regional Health Center in Mansa district were laboratory confirmed. As a result, a mass MCV campaign was carried out in the Paul-Mambilima Regional Health Center catchment area for children between the ages of 4 months and 15 years. The highest number of suspected measles cases (43 cases) was reported during week 47 (Figure 1). Twenty of the 43 cases were reported from Central province.

Without factoring the total population at risk per province, Luapula province reported the highest number of suspected measles cases (114 suspected cases) in 2018, and North-western province reported the second highest number of suspected measles cases (83 suspected cases). The lowest numbers of suspected measles cases were observed in Eastern (18 suspected cases) and Muchinga (6 suspected cases) provinces (Figure 3).

Suspected cases of measles are confirmed by laboratory testing.  Blood samples are collected from suspected cholera cases and sent to UTH for serologic testing for measles virus specific antibodies (IgM).  In 2016, 61% of all suspected cases had blood samples sent to UTH for laboratory confirmation. In 2017 and 2018 75% and 62% of suspected cases were tested at UTH, respectfully (Table 1).   Of the 420 blood samples sent for laboratory confirmation in 2016, only 6 (1.4%) tested positive for measles. In 2017, 456 samples were sent for laboratory confirmation and only 12 (2.6%) were positive (Table 1). In 2018, only 19 (5.5%) out of the 344 suspected blood samples tested positive. The highest number of confirmed measles cases (13 cases) in 2018 occurred during the third quarter (Table 1).

During this same period, MCV1 coverage in Zambia decreased from 97% in 2016 to 93% in 2018 (Figure 4). Despite the decrease in MCV1 coverage, MCV2 coverage increased from 58% in 2016 to 66% in 2018 (Figure 4).

Figure 3: Reported suspected measles cases by province  2018

 

 

Figure 4: Measles immunisation coverage in Zambia (2016 – 2018)

 

Discussion

In 2018 Zambia reported 558 suspected measles cases.  Peaks in the numbers of reported suspected measles cases occurred on epidemiological weeks 17, 30, and 47. A field investigation into an increase in suspected measles cases in Luapula province on week 30 led to a mass MCV campaign in Mansa district.  Slightly more than one third of all measles cases reported in 2018 were from Lupuala and North-western provinces.  These provinces border the Democratic Republic of the Congo, where ongoing conflicts and disease outbreaks have disrupted routine childhood immunisations and led to an increase in cases of vaccine-preventable diseases. As a result, the DRC reported 6,949 suspected cases of measles in 2018.

Similarly, the 2010-2011 measles outbreak in Zambia was largely influenced by cross-border transmission of measles from neighboring countries with low MCV coverage.   Spatial clustering of the 2010-2011 outbreak showed that frequent border crossing of the Chewa people between Zambia and Malawi led to measles importation in border towns8.

The measles virus can only remain in circulation in human populations if transmission is undisrupted.

In order to achieve herd immunity and prevent the transmission of measles, 90-95% of a population must be immune to the disease1. The goal of the Zambian government is to achieve 95% MCV coverage in children under 5 years old. In 2016, 97% of children under the age of 1 year received MCV1, and 58% of children under the age of 2 years received MCV2. MCV1 coverage decreased to 93% in 2018, below the 95% goal, yet MCV2 coverage increased to 66%. High levels of MCV1 and MCV2 must be maintained in order to eliminate measles in Zambia and reduce the risk of cross-border transmission of measles from neighboring countries.

Several factors can influence vaccine uptake, including availability of vaccines, proximity of populations to health facilities, cultural or religious beliefs, and poor knowledge of or misinformation about vaccines. In resource poor areas, researchers have found that some nurses are reluctant to open a multi-dose vaccine, for fear that they will waste the remaining doses. Furthermore, as measles cases become more rare, the perceived threat of measles in the population decreases, causing vaccination compliance to also decrease9.

Review of the 2016-2018 laboratory data showed that only 0.8% (2016) to 3.4% (2018) of suspected measles cases were identified as positive by laboratory confirmation.  This is partly due to the suspected measles case definition used by the IDSR. The suspected case definition is very broad, because the definition must be highly sensitive in order to detect all measles cases and prevent rapid spread of measles. It is less important for the case definition to be specific, so many other viral diseases are detected using the suspected measles case definition. However, another factor is that the proportion of blood samples collected from suspected measles cases for laboratory confirmation was only 62% in 2018. According to WHO, ≥ 80% of all suspected measles cases must provide blood samples in order to detect an outbreak10.  Therefore, Zambia must increase sample collection from suspected measles cases in order to attain the required minimum 80% to efficiently to detect an outbreak.

Conclusion & Recommendations

Due to improvements in routine childhood immunisation programs and national surveillance systems over the past 20 years, the number of suspected measles cases in Zambia has decreased drastically from 35,572 in 2010 to 558 in 2018.

While it is evident that Zambia is making progress towards achieving the 95% WHO recommended vaccination coverage, much work must be done to improve MCV2 coverage. In order to interrupt measles transmission in the country, areas with low vaccine coverage should be targeted, with an emphasis on strengthening immunisation coordination programs in border regions.

Zambia in partnership with the WHO and UNICEF have greatly improved measles surveillance over the last two decades by implementing IDSR. IDSR has helped with early detection of measles cases and the prevention of large scale outbreaks. However, it is important to continue to train healthcare workers in IDSR definitions in order to promote timely and accurate reporting of data. Sensitization of healthcare workers about measles case definitions and reporting procedures could also help increase the proportion of suspected measles cases for whom samples are collected and sent to UTH for laboratory confirmation.

Table 1: Measles laboratory confirmation in Zambia (2016-2018)

List of References

1. Moss WJ. Measles. Lancet. 2017;390(10111):2490–502.

2. Moss WJ, Griffin DE. Global measles elimination. Nat Rev Microbiol. 2006;4(12):900–8.

3. Mpabalwani M, Matapo B , Katepa-Bwalya M , Mukonka V, Mutambo H, Babaniyi OA. The 2010–2011 measles outbreak in Zambia: challenges and lessons learnt for future action. East Afr J of Public Health. 2013; 10(1): 265–273.

4. Centers for Disease Control and Prevention. Progress in Measles Control – Zambia, 1999—2004. MMWR Morb Mortal Wkly Rep. 2005;54(23):581-584.

5. Pinchoff J, Chipeta J, Banda GC, Miti S, Shields T, Curriero F, et al. Spatial clustering of measles cases during endemic (1998-2002) and epidemic (2010) periods in Lusaka, Zambia. BMC Infect Dis. 2015;15:121.

6. World Health Organization and United Nations Children’s Fund. Zambia: WHO and UNICEF Estimates of Immunization Coverage: 2015 Revision. 2017. URL: http://www.who.int/immunization/monitoring_surveillance/data/zmb.pdf

7. World Health Organization. Measles and Rubella Surveillance Data. URL: http://www.who.int/immunization/monitoring_surveillance/burden/vpd/surveillance_type/active/measles_monthlydata/en/

8. Brownwright TK, Dodson ZM, Van Panhuis WG. Spatial clustering of measles vaccination coverage among children in sub-Saharan Africa. BMC Public Health. 2017;17(1):957.

9. Rainey JJ, Watkins M, Ryman TK, Sandhu P, Bo A, Banerjee K. Reasons related to non-vaccination and under-vaccination of children in low and middle income countries: findings from a systematic review of the published literature, 1999-2009. Vaccine. 2011;29(46):8215–21.

10. Spika JS, Wassilak S, Pebody R, Lipskaya G, Deshevoi S, Guris D, et al. Measles and rubella in the World Health Organization European region: diversity creates challenges. J Infect Dis. 2003;187 Suppl 1:S191-197.

Facebooktwittergoogle_pluslinkedinmail

Measles Viruses in Zambia: A Review on Circulating Wild-type Genotypes and Complications with Human Immunodeficiency and control (2006-16)

K Ndashe1, S Munjita2, N Tembo3, S Musanka2, B Mumba1

1. Department of Environmental Health, Faculty of Health Science, Lusaka Apex Medical University, Lusaka, Zambia

2. Department of Biomedical Sciences, School of Medicine, the University of Zambia, Lusaka, Zambia.

3. Department of Public Health, School of Health Sciences, University of Lusaka, Lusaka, Zambia.

Correspondence: Kunda Ndashe (ndashe.kunda@gmail.com)

Download PDF


Citation style for this article: Ndashe K, Munjita S, Tembo N, Musanka S, Mumba B. Measles Viruses in Zambia: A Review on Circulating Wild-type Genotypes and Complications with Human Immunodeficiency Virus and control (2006-2016). Health Press Zambia Bull. 2019;3 (1); pp 7-14.

This work has been adapted from the original article “[ IMeasles Viruses in Zambia: A Review on Circulating Wild-type Genotypes and Complications with Human Immunodeficiency Virus]” by [Kunda Ndashe, Samuel Munjita, Novan Tembo, Sody Musanka, Bernadette Mumba and with input from the Journal of Preventive and Rehabilitative Medicine ]. Vol. 1, No. 1, 2018, pp. 5-11. doi: 10.21617/jprm.2018.0101.1


Measles is a highly contagious disease that most commonly affects children. The disease continues to record morbidity and mortality among infants in Zambia. We searched online databases such as PubMed, Scopus, Google Scholar, and National Center for Biotechnology Information (NCBI) database and ISI Web of Science and critically reviewed appropriate publications to extract consistent findings, the wild-type MeV present in Zambia, the complications of Measles and the Human immunodeficiency Virus and the control of Measles in Zambia. We included 18 research articles and 2 epidemiological bulletins in the synthesis. From the search of the NCBI database a total of 80 nucleotide sequences of 48 MeV isolates were obtained, 34 sequences (25 MeV isolates) from Zambia and 46 sequences (23 MeV isolates) WHO reference strains. Out of the 34 sequences from Zambia, 9 and 25 were H-gene and N-gene nucleotide sequences, respectively. This study identified 3 MeV genotypes in Zambia (B2, B3 and D2) spatially distributed in Lusaka, Ndola, Kitwe, Mwense and Samfya. Infants born from women who are HIV-1 seropositive had lower maternal antibodies and post initial vaccination antibodies to measles in HIV-1-infected infants waned off rapidly. The review re-emphasized the need for supplemental immunisation activities which include second opportunity to immunisation and case-based surveillance.

Key words: Measles virus, genotypes, control, Zambia

1. Introduction

Measles is a highly contagious disease that most commonly affects children. It is caused by an enveloped nonsegmented, negative stranded RNA Measles virus (MeV) of the genus Morbillivirus, family Paramyxoviridae [1]. The MeV genome encodes a total of eight proteins. The six structural proteins are the nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), fusion protein (F), attachment protein (H), and the large error-prone RNAdependent RNA polymerase protein (L) [2]. Two additional nonstructural proteins (C and V) are encoded in the P transcription unit. While the C protein is translated from an overlapping reading frame within the P gene, the V protein is initiated from the same start codon as P, but a frame-shift is created by mRNA editing [3]. The outcome is that P and V share an N-terminal domain of 231 amino acids, but differ in their C-terminal domains (276 and 69 amino acids, respectively). The N and H gene sequences are most commonly used for genetic characterization of wild-type MeV [4]. The World Health Organisation (WHO) currently recognizes 8 clades, designated A, B, C, D, E, F, G, and H. Within these clades, there are 23 recognized genotypes, designated A, B1, B2, B3, C1, C2, D1, D2, D3, D4, D5, D6, D7, D8,D9, D10, E, F, G1, G2, G3, H1, and H2, and 1 provisional genotype, d11 [5].

In the developed world, measles immunisation programmes have reduced the number of cases reported annually to negligible levels [6]. Nonetheless, measles remains a major health problem in densely populated urban communities in sub-Saharan Africa [7]. In Zambia, measles is endemic with transmission peaks occurring between August and December, despite the relentless efforts of immunisation [8]. Since 1992, MeV has been isolated from children admitted to hospital in Lusaka, Zambia. Between 1992 and 1995, the University Teaching Hospital in Lusaka clinically diagnosed 1066 children with measles of which 203 (19.0%) were less than the 9 months of age which is the recommended time for measles vaccination in Zambia [8]. In another study conducted in Zambia, out of 277 children with clinical measles that were admitted to the University Teaching Hospital, of 149 samples tested, 132 (88.6%) were positive for IgM antibody while 14 (20.9%) of 67 samples, measles viruses were isolated [9]. The latter study highlights the importance of confirmatory tests in the diagnosis of measles to avoid misdiagnosis, since other clinical conditions may cause similar symptoms to measles. Genetic analysis of MeV in a region helps document the effectiveness of control measures. In areas that have endemic transmission of measles, virologic surveillance of cases detects a limited number of genotypes while in areas where endemic transmission of virus has been interrupted, a variety of genotypes are detected, reflecting the multiple sources of imported viruses [10]. The virologic surveillance information has shown that vaccination programs can reduce the number of co-circulating chains of transmission and eventually interrupt measles transmission [11]. However, viruses are continually being introduced from external sources, and if the number of susceptible individuals increases, sustained transmission of the newly introduced viral genotype is possible. This results in what appears as a rapid change in the endemic genotype [12, 13]. The genetic stability of MeV is exceptionally high, and it has been observed that it undergoes remarkably little sequence variation over long periods of time, both in laboratory settings and in the field [14]. Therefore, genetic analysis of MeV in endemic areas such as Zambia helps to document the genotype of circulating virus strains, effectiveness of immunisation and possible introduction of new genotypes from other countries or regions. The article reviews the wild-type MeV present in Zambia, the complications of Measles and the Human immunodeficiency Virus and the control of Measles in Zambia.

2. Methodology

We searched PubMed, Scopus, Google Scholar, and ISI Web of Science (up to November 17, 2017) using the following search terms: “Epidemiology of Measles in Zambia”, “Genotype of Measles Virus in Zambia”, “Measles and Human Immunodeficiency Virus in Zambia”. We supplemented database searches by screening bibliographies of the articles. Two independent reviewers (KN, NT) screened article titles and abstracts to select articles for full-text screening. The reviewers of the current paper assessed full texts independently; in case of disagreement, they consulted a third author (SM), and agreed upon a decision by consensus. We further searched the National Center for Biotechnology Information (NCBI) database for all available nucleotide sequences of MeV isolated from Zambia and WHO reference strains that are used for genetic analysis. The obtained MeV nucleotide sequences were then analysed using Bioedit and MEGA 6 software. Phylogenetic trees were constructed in MEGA6 using the neighbor-joining method with the Kimura two-parameter evolutionary model [15, 16].

3. Results

The primary search identified 58 papers. We removed 24 duplicates. We screened 34 articles to assess eligibility, and excluded 16 that did not meet the inclusion criteria. We included 18 articles in the synthesis. We also included 2 epidemiological bulletins and alert from WHO and CDC. From the search of the NCBI database a total of 80 nucleotide sequences of 48 MeV isolates were obtained, 34 sequences (25 MeV isolates) from Zambia and 46 sequences (23 MeV isolates) WHO reference strains (Table 1). Out of the 34 sequences from Zambia, 9 and 25 were Hgene and N-gene nucleotide sequences, respectively. Topologically, the phylogenetic tree of the N-gene, MeV was separated in 8 groups and the Zambian isolates identified in 3 groups (Figure 1). While phylogenetic tree of the H-gene showed that the Zambian isolates to belong to one group (Figure 2). The Zambian MeV isolates were clustered in the genotypes B2, B3 and D2. Geographical distribution of the MeV in Zambia revealed that genotype B3 was found in Lusaka, Ndola, Kitwe, Samfya and Mwense, genotype B2 in Kitwe and genotype D2 in Lusaka (Figure 3).

Table 1: Measles Virus isolates from Zambia and WHO reference strains

Figure 1: Phylogenetic relationships of the N-gene of MeV detected in clinical patients in Zambia and the WHO reference strains. Phylogenetic analysis was based on 456 bp of the N-gene. Isolate names for nucleotide sequences included in the analyses are given in parentheses

Figure 2: Phylogenetic relationships of the H-gene of MeV detected in clinical patients in Zambia and the WHO reference strains. Phylogenetic analysis was based on 1504 bp of the H-gene. Isolate names for nucleotide sequences included in the analyses are given in parenthese

Figure 2: Phylogenetic relationships of the H-gene of MeV detected in clinical patients in Zambia and the WHO reference strains. Phylogenetic analysis was based on 1504 bp of the H-gene. Isolate names for nucleotide sequences included in the analyses are given in parenthese

4. Discussion

The wild type measles virus genotypes circulating in Zambia Molecular analysis of MeV serves as an important tool to understand the circulating strains of the virus in a region and efforts made in controlling outbreaks through immunisation. This study identified 3 MeV genotypes in Zambia. The genotypes B2, B3 and D2 were isolated from patients clinically diagnosed with measles in Lusaka, Ndola, Kitwe, Mwense and Samfya. The genotype B3 was common in all the 5 districts while B2 and D2 genotypes were unique to Kitwe and Lusaka, respectively. The finding of this review agrees with other workers that have reported MeV in Zambia. Rota and Bellini (2003) and Riddell et al (2005) reported that the genotype D2 was circulating in Zambia and South Africa while Rota et al (2011) further revealed that between 2007 and 2009, 21 genotype B2 sequences were reported from the Democratic Republic of the Congo, Zambia, and Angola [11, 17, 18]. Results of the study further revealed that the genotypes were identified between 2006 and 2014 after Zambia had adopted strategies to accelerate measles control, which included conducting case based surveillance [19]. The complications of Measles and the Human immunodeficiency Virus The co-infection of measles and Human immunodeficiency Virus (HIV) has resulted in complications in the immunisation of the former. It has been reported that infants born to women infected with HIV have lower titres of maternal antibodies to MeV and are at higher risk of contracting measles before the mandatory age of vaccination which is at 9 months in most sub-Saharan countries [20, 21]. Moss et al (2007) in a study in Lusaka reported that HIV-1–infected Zambian children developed antibody levels considered to be protective after measles vaccination at approximately 9 months of age, with comparable frequency to that achieved by HIV-1– uninfected children [22]. The research further revealed that antibody levels to measles vaccine in HIV-1-infected children waned off rapidly surviving up to 2 to 3 years. Scott et al (2007) also reported that levels of maternal antibodies to MeV were lower during the first 9 months of life in Zambian infants born to HIV-1–infected women than in infants born to uninfected women furthermore these levels were lower in HIV-1–infected infants than in HIVseropositive but uninfected infants [23]. Therefore, the HIV-1- infected infants are at increased risk of measles before the mandatory age of routine vaccination at 9 months but are also less likely to have levels of maternal antibodies that would neutralize measles vaccine virus. The World Health Organisation (WHO) recommends a second measles vaccination for all children, either through repeated campaigns or a routine second dose [24].

Measles Control in Zambia

Before 2003, Zambia controlled measles through single dose administration of the measles containing vaccine (MCV) to infants at age of 9 months [19]. Between 1992 and 1999, an average of 11,787 suspected measles case were reported annually, ranging 5, 983 in 1998 to 23, 518 in 1999 [19, 26]. During the same period the national measles immunisation coverage ranged from 61% in 1993 to 93% in 1996. In the quest of controlling measles outbreaks, in 2003, Zambia adopted a strategy of supplemental immunisation activities (SIA) which included strengthening routine vaccination, providing a second opportunity for measles immunisation for all children between 9 months and 4 years, and conducting case-based surveillance [25]. Since it was reported by Moss et al (2007) that MeV antibody titres wane off rapidly in HIV-1- infected children, the second opportunity for measles immunisation offers booster vaccination for prolonged protection against the disease. Lowther et al (2009) reported that 3 years after a successful SIA that markedly decreased incidence and mortality of measles in Zambia, 84% of children within the study townships had a history of measles immunisation and only 67% had detectable antibodies to MeV in oral fluid samples [27]. This result suggested a build-up of susceptible children and a population at risk for measles outbreaks. It was observed that HIV-1-infected children did not contribute substantially to the pool of susceptible children. In 2016 the Ministry of Health (MoH) in its continued efforts to improve child health introduced the Measles Rubella vaccine (MR) in the national routine immunisation system. The vaccine was given to children at the same age as measles vaccine for the first and second doses at 9 months and 18 months respectively during routine immunisation [28]. The introduction of MR vaccine was a necessary step to accelerate progress towards achieving the global goal of measles and rubella elimination by the year 2020 set by the Measles and Rubella Initiative (M&R) Initiative [28]. Zambia reported improvements in under 5 mortality declining from 168 deaths per 1000 live births in 2002 to 75 deaths per 1000 live births in 2014 and are directly attributed to sustained immunisation coverage and other child health interventions [29].

5. Conclusion

Continued monitoring of the MeV genotypes in clinically diagnosed cases is necessary to document the circulating wild-types in order to monitor the efforts of immunisation campaigns. Zambia is well vested with human resource and laboratory capacity to conduct the routine MeV surveillance. Infants born from women infected with HIV1 should be given the first MeV vaccine at 6 months of age because they have lower levels of MDA to Measles. As recommended by WHO a second opportunity for measles vaccination for all children is necessary, because of the reported waning immunity among HIV-1–infected children. Therefore, sufficient resources ought to be allocated towards surveillance and vaccination campaigns by the Ministry of Health (MoH) in Zambia.

Recommendations

Knowledge gaps in the epidemiology of measles over an extended period need to be addressed in the elimination of the disease in Zambia. This information is incredibly valuable as predictable epidemiological patterns emerge as measles elimination is approached and achieved. These critical features, including the source, size and duration of outbreaks, the seasonality and age-distribution of cases, genotyping pointers and effective reproduction rate shall be necessary in the control of the disease.

Author contributions

K.N conceived of the research idea. K.N and SM1 developed the theory and performed the computations. N.T and SM2 verified the analytical methods. BM. encouraged K.N. to investigate [control of measles] and supervised the findings of this work. All authors discussed the results and contributed to the final manuscript.

Acknowledgements

We would like to thank Drs. Oswell Khondowe and Margaret Mweshi for the constructive criticism and guidance during the preparation of the manuscript.

List of References

1. Griffin DE. Measles virus. In Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE. Fields virology, vol. 1. Philadelphia (EUA): Lippincott Williams & Wilkins. 2001, pp 1042–1065.

2. Bankamp B, Lopareva EN, Kremer JR, Tian Y, Clemens MS, Patel R, Fowlkes AL, Kessler JR, Muller CP, Bellini WJ, Rota PA. Genetic variability and mRNA editing frequencies of the phosphoprotein genes of wild-type measles viruses. Virus research. 2008 Aug 1; 135 (2):298- 306.

3. Xu WB, Tamin A, Rota JS, Zhang L, Bellini WJ, Rota PA. New genetic group of measles virus isolated in the People’s Journal of Preventive and Rehabilitative Medicine 11 Republic of China1. Virus research. 1998 Apr 1; 54 (2):147-56.

4. Rima BK, Earle JA, Baczko K, Ter Meulen V, Liebert UG, Carstens C, Caraba J, Caballero M, Celma ML, FernandezMu R. Sequence divergence of measles virus haemagglutinin during natural evolution and adaptation to cell culture. Journal of General Virology. 1997 Jan 1; 78 (1):97-106. 5. World Health Organization. Update of the nomenclature for describing the genetic characteristics of wild-type measles viruses: new genotypes and reference strains. Weekly Epidemiological Records. 2003.78(27):229–232

6. Tulchinsky TH, Ginsberg GM, Abed Y, Angeles MT, Akukwe C, Bonn J. Measles control in developing and developed countries: the case for a two-dose policy. Bulletin of the World Health Organization. 1993; 71 (1):93.

7. Kambarami RA, Nathoo KJ, Nkrumah FK, Pirie DJ. Measles epidemic in Harare, Zimbabwe, despite high measles immunization coverage rates. Bulletin of the World Health Organization. 1991; 69 (2):213.

8. Oshitani H, Mpabalwani M, Kasolo F, Mizuta K, Luo NP, Bhat GJ, Suzuki H, Numazaki Y. Measles infection in hospitalized children in Lusaka, Zambia. Annals of tropical paediatrics. 1995 Jun 1; 15 (2):167-72.

9. Oshitani H, Suzuki H, Mpabalwani M, Mizuta K, Kasolo FC, Luo NP, Numazaki Y. Laboratory diagnosis of acute measles infections in hospitalized children in Zambia. Tropical Medicine & International Health. 1997 Jul 1; 2 (7):612-6.

10. Rota PA, Liffick SL, Rota JS, Katz RS, Redd S, Papania M, Bellini WJ. Molecular epidemiology of measles viruses in the United States, 1997–2001. Emerging infectious diseases. 2002 Sep; 8(9):902.

11. Rota PA, Brown K, Mankertz A, Santibanez S, Shulga S, Muller CP, Hübschen JM, Siqueira M, Beirnes J, Ahmed H, Triki H. Global distribution of measles genotypes and measles molecular epidemiology. The Journal of infectious diseases. 2011 Jul 1; 204(suppl_1):S514-23.

12. Rima BK, Earle JA, Yeo RP, Herlihy L, Baczko K, Ter Meulen V, Carabana J, Caballero M, Celma ML, Fernandez-Munoz R. Temporal and geographical distribution of measles virus genotypes. Journal of General Virology. 1995 May 1; 76(5):1173-80.

13. Santibanez S, Tischer A, Heider A, Siedler A, Hengel H. Rapid replacement of endemic measles virus genotypes. Journal of General Virology. 2002 Nov 1; 83 (11):2699-708.

14. Beauty SM, Lee B. Constraints on the genetic and antigenic variability of measles virus. Viruses. 2016 Apr 21; 8 (4):109.

15. Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of molecular evolution. 1980 Jun 1; 16 (2):111-20.

16. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution. 2013 Oct 16; 30 (12):2725-9.

17. Riddell MA, Moss WJ, Hauer D, Monze M, Griffin DE. Slow clearance of measles virus RNA after acute infection. Journal of clinical virology. 2007 Aug 1; 39 (4):312-7.

18. Rota PA, Bellini WJ. Update on the global distribution of genotypes of wild type measles viruses. Journal of Infectious Diseases. 2003 May 15; 187 (Supplement_1):S270-6.

19. Centres for Disease Control and Prevention (CDC. Measles incidence before and after supplementary vaccination activities–Lusaka, Zambia, 1996-2000. MMWR. Morbidity and mortality weekly report. 2001 Jun 22; 50 (24):513.

20. Moss WJ, Cutts F, Griffin DE. Implications of the human immunodeficiency virus epidemic for control and eradication of measles. Clinical Infectious Diseases. 1999 Jul 1; 29 (1):106-12.

21. Taylor WR, Ma-Disu MA, Weinman JM. Measles control efforts in urban Africa complicated by high incidence of measles in the first year of life. American journal of epidemiology. 1988 Apr 1; 127 (4):788-94.

22. Moss WJ, Scott S, Mugala N, Ndhlovu Z, Beeler JA, Audet SA, Ngala M, Mwangala S, Nkonga-Mwangilwa C, Ryon JJ, Monze M. Immunogenicity of standard-titer measles vaccine in HIV-1-infected and uninfected Zambian children: an observational study. The Journal of infectious diseases. 2007 Aug 1; 196 (3):347-55.

23. Scott S, Moss WJ, Cousens S, Beeler JA, Audet UA, Mugala N, Quinn TC, Griffin DE, Cutts FT. The influence of HIV-1 exposure and infection on levels of passively acquired antibodies to measles virus in Zambian infants. Clinical infectious diseases. 2007 Dec 1; 45 (11):1417-24.

24. World Health Organization. Strategies for reducing global measles mortality. Weekly Epidemiology Records 2000; 75:411–6.

25. Centres for Disease Control and Prevention (CDC. Measles incidence before and after supplementary vaccination activities–Lusaka, Zambia, 1996-2000. MMWR. Morbidity and mortality weekly report. 2001 Jun 22; 50(24):513.

26. Mpabalwani ME, Matapo B, Katepa-Bwalya M, Mukonka V, Mutambo H, Babaniyi OA. The 2010-2011 measles outbreak in Zambia: Challenges and lessons learnt for future action. East African Journal of Public Health. 2013; 10 (1):265-73.

27. Lowther SA, Curriero FC, Kalish BT, Shields TM, Monze M, Moss WJ. Population immunity to measles virus and the effect of HIV-1infection after a mass measles vaccination campaign in Lusaka, Zambia: a cross sectional survey. Lancet 2009; 373:1025–32

28. More than 6 million Zambian children to be vaccinated against measles and rubella in a nationwide vaccination campaign. World Health Organisation. [Cited Feb 20 2018]. Available from: www.afro.who.int/news/more-6-millionzambian-children-be-vaccinated-against-measles-andrubella-nationwide

29. Mpabalwani EM, Simwaka CJ, Mwenda JM, Mubanga CP, Monze M, Matapo B, Parashar UD, Tate JE. Impact of rotavirus vaccination on diarrheal hospitalizations in children aged< 5 years in Lusaka, Zambia. Clinical Infectious Diseases. 2016 Apr 7; 62(suppl-2):S183-7.

Facebooktwittergoogle_pluslinkedinmail

Challenges of implementing the integrated disease surveillance and response strategy in Zambia: a health worker perspective

CB Mandyata, LK Olowski, W Mutale

University of Zambia School of Public Health, Lusaka, Zambia

Download PDF

Correspondence: Brian Mandyata: (mbchomba@gmail.com)


Citation style for this article: Mandyata CB, Olowski LK, Mutale W. Challenges of implementing the integrated disease surveillance and response strategy in Zambia: a health worker perspective. Health Press Zambia Bull. 2018;2(12); pp 17-29. This work has been adapted from the original article “[ Challenges of implementing the integrated disease surveillance and response strategy in Zambia: a health worker perspective]” by [Chomba Brian Mandyata, Linda Kampata Olowski, Wilbroad Mutale]. BMC Public Health 201717:746 (https://doi.org/10.1186/s12889-017-4791 9; https://bmcpublichealth.biomedcentral.com/articles/10.1186/s12889-017-4791-9#Decs). The original article is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


Despite advances in medical technology and public health practice at the global level over the past millennia, infectious diseases are still the leading causes of death in most resource limited countries. Stronger infectious disease surveillance and response systems in developed countries facilitated the near elimination of infectious disease related deaths in those countries. Today, low-income countries are following this path by strengthening disease surveillance and response strategies that would help reverse the trend in infectious disease associated morbidity and mortality cases. In 2000, Zambia adopted the World Health Organisation Regional Office for Africa’s (WHO-AFRO) Integrated Disease Surveillance and Response Strategy (IDSR) to monitor, prevent and control priority notifiable infectious diseases in the country. Through this strategy, activities pertaining to disease surveillance are coordinated and streamlined to take advantage of similar surveillance functions, skills, resources and targeted populations. The purpose of the study was to investigate and report on the existing challenges in the implementation of the IDSR strategy in a resource limited country from a health worker perspective.

Methods: A qualitative study approach was used to achieve the study aim. Data was collected through key informant interviews with selected persons at the Lusaka Province Health Office (LPHO); Lusaka and Chongwe District Health Management Team Offices; and four selected health facilities in the two districts (two from each). Thematic analysis approach was used to analyse the qualitative data.

Results: The major successes included operationalised response and epidemic preparedness at all levels (National to district); full-time staff and budget dedicated to disease surveillance at all levels and adoption of the 2010 World Health Organisations’ Integrated Disease Surveillance and Response Strategy technical guidelines to the Zambian context. Several challenges hampered effective implementation. These include inadequate trained human resources, poor infrastructure and coordination challenges.

Conclusion: The implementation of IDSR strategy in Zambia has recorded some successes. However, several gaps hinder effective implementation. It is imperative that these gaps are addressed for Zambia to have a robust surveillance system that could inform policy in a comprehensive and timely manner.

Background

Background A disease surveillance system that continuously and systematically collects, analyses, interprets and utilise health data for decision making at an optimum level is a corner stone of an effective public health system [1, 2]. Disease surveillance systems provide information about disease manifestations and severity, etiological characteristics of the disease, their space-time distributions, the use of and potency of treatments that is vaccines and so on and so on [3–5]. During the 1990s, most African health systems extensively implemented vertical disease surveillance and response strategies for each priority infectious disease that was targeted for control and/or elimination. Several drawbacks had been identified with these types of systems and these included: high cost of maintaining the various parallel systems; inability of the several vertical disease surveillance strategies to adequately fulfil the functions of surveillance and response; heavily centralised systems; inability to detect disease outbreaks in a timely manner; duplication of work due to lack of coordination between several single disease control and prevention programmes; overburdened health personnel responsible for disease surveillance in terms of workload and so on [6–11]. Furthermore, these vertical disease surveillance strategies were also failing to cope with the increasing ease of travel of their targeted populace (mostly propagated by air travel), the rapid urbanisation of African cities, and the associated public health challenges that come with them coupled with the incremental threat of emerging and re-emerging diseases of pandemic potential alongside endemic diseases such as Human Immunodeficiency Virus (HIV), Hepatitis and other diseases. Meanwhile, the financial costs for implementing these vertical programmes kept on skyrocketing while at the same time most African economies at the time were either declining or remained stagnant. This situation in the continent of Africa at that time prompted the World Health Organisation Regional Office for Africa (WHO-AFRO) to develop a cost effective and efficient disease surveillance and response strategy for African member countries. The strategy was adopted under resolution AFR/RC48/R2 by the WHO-AFRO member countries in September 1998 when the World Health Organisation Regional Committee for Africa met in Harare, Zimbabwe [12].Some of the aims of the IDSR strategy are to: “train personnel at all levels; develop and carry out plans of action; advocate and mobilise resources; integrate multiple surveillance systems so that forms, personnel and resources can be used more efficiently; improve the use of information to detect changes in time to conduct a rapid response to suspected epidemics and outbreaks; monitor the impact of interventions; facilitate evidence-based response to public health events; and inform health policy design, planning and programme management; improve the flow of surveillance information between and within [various] levels of the health system; strengthen laboratory capacity and involvement in confirmation of pathogens and monitoring of drug sensitivity; emphasise community participation in detection and response to public health problems including event based surveillance and response in line with IHRs [International Health Regulations of 2005]” [12]. Under article 5.1 of the resolutions of the IHRs, it is stated that each country will have to develop, strengthen and maintain, as soon as possible but no later than five years from the date of entry into force of the resolutions for that particular country (June 2007 for Zambia) the capacity to detect, assess, notify and report public health events of international concern in accordance with the set parameters contained within the resolutions [13]. These regulations require that each member country develops, operates and manages a real time health event monitoring and strengthened surveillance system [14]. In Zambia, the IDSR has been used to complement the Health Management Information System (HMIS) in reporting detected priority notifiable infectious diseases to the relevant authorities within the Ministry of Health [15]. Within the HMIS, there are indicators for 11 priority notifiable infectious diseases which are reported to the next level in the reporting chain immediately they are detected/suspected and/or confirmed and these include: Acute Flaccid Paralysis (AFP); Measles; Neonatal Tetanus; Dysentery; Cholera; Plague; Rabies; Typhoid Fever; Yellow Fever; Tuberculosis (TB) and Human Influenza [15]. Notifications of these diseases and health events to the public health authorities in Zambia is mandated by law under the Public Health Act of 1995 [16], Ministry of Health regulations that is, the 2011 Technical Guidelines on IDSR in Zambia [17] and by the IHRs of 2005 [13]. Surveillance data collection is conducted mainly at the health facility level where in most cases paper-based information systems are used to collect information about suspected and confirmed priority notifiable infectious diseases and the associated mortality cases. Tallied information from these tools is then sent to respective District Health Management Team Offices (DHMTs), who then feed the validated data into the District Health Information System version II (DHIS II) – an internet based system with the main aim of reducing the reporting burden in primary health care settings by focusing and easily making available essential information for district level planning [18].

IDSR implementation structure in Zambia

In order to effectively and efficiently achieve the aims of the IDSR in the Zambian public health system, the Ministry of Health developed and operationalised the IDSR implementation structure. It emanates from the community level up to the national level. Figure 1 below further illustrates this structure. It shows the surveillance data flow from the community level up to the Ministry of Health headquarters. When members of the community suspect a disease, it is expected of them to report themselves and/or others to the nearest health facility. In the event that the health facility detects/suspects a notifiable infectious disease(s), it is required of them (health facilities) to report such cases to their respective District Health Management Teams (DHMTs) within a specified period of time usually on a weekly and monthly basis. Once the DHMTs receive the surveillance data, the health information unit through the District Health Information Officer (DHIO) then compile, validate, analyse and disseminate the received surveillance counts to other office units that is, policy and planning, Sampling of key informants

Sampling of key informants Targeted key informants were those that were directly involved in the implementation of the IDSR at each level of health service delivery. From the Epidemiological Unit – which falls under the Directorate of Public Health,

The disease surveillance unit at the DHMT institutes and leads further epidemiological investigations into any suspected and confirmed priority notifiable infectious disease and/or any public health event of concern with technical support from the respective Provincial Health Offices. At the same time, the DHMTs forward the received surveillance counts to the Disease Surveillance Unit at the Provincial Health Office who perform the same processes on the received data as the DHMTs. Once everything has been deemed to be satisfactory (by approval of the Provincial Disease Surveillance Officer), the respective Provincial Health Offices then send the provincial surveillance counts to the Ministry of Health headquarters. The disease surveillance section at the Provincial Health Office is mandated to provide supervisory and technical support to the DHMTs under their jurisdiction in all disease surveillance activities including case investigations and response. The monthly disease surveillance counts are typically compiled and managed by the Monitoring and Evaluation unit mostly by the District Health Information Officers (DHIOs) while weekly disease surveillance counts are compiled and managed by the Epidemiological section of the Ministry of Health through the Disease Surveillance Officers – where these positions have been filled. Otherwise, DHIOs or the Environment Health Officers (EHO) also perform the duties of a Disease Surveillance Officer. The aim of the study was to investigate and report on some of the existing challenges in the implementation of the Integrated Disease Surveillance and Response Strategy in a low-income country such as Zambia by documenting the health worker perspectives.

Methods

Study setting

Geographically, Lusaka province is centrally located on the map of Zambia. It covers a total surface area of approximately 21, 896 km2 with an estimated total population of 2, 191, 225 [19]. In the east, the province borders Mozambique at Luangwa district and Zimbabwe in the south at Chirundu district. The province has a total of seven districts namely; Lusaka (provincial and country administration capital), Chirundu, Chilanga, Chongwe, Kafue, Luangwa and Rufunsa.

Study design

The study utilised a qualitative approach in its quest to achieve the study aims. Primary qualitative data was collected through key informant interviews with purposively sampled health workers at all levels of IDSR implementation.

Sampling procedure

Figure 2 above shows the hierarchy (within the IDSR implementation structure) of key informants that were interviewed for this study. The study had purposively sampled the Ministry of Health headquarters and Lusaka Provincial Health Office (LPHO). The study then conveniently sampled two district health administration offices (one urban and one rural) both of which are under the jurisdiction of the LPHO and these were; the Lusaka District Health Management Team Office (LDHMT) located in an urban area; and the Chongwe District Health Management Team Office (CDHMT) – a rural district (Chongwe) located about 40 km east of Lusaka district. In each of the two sampled districts, two health facilities were purposively sampled. At least one of these health facilities in each sampled district had to possess an in-house laboratory capacity of some kind. All health facilities sampled were under the direct super vision of their respective DHMTs. The sampling of only two districts is adequate to show the status of the IDSR implementation for all the other districts and health facilities in the country.

This is because the procedures for implementing the IDSR is standardised for all districts and facilities (public or private) irrespective of their size, status or location that is urban or rural, health post or district hospital. This standardisation is stipulated in the 2011 Technical Guidelines for IDSR in Zambia [17] and the Public Health Act of 1995 [16]. Therefore, the findings from this study are transferable to other similar districts throughout the country.

Disease Surveillance and Research, an IDSR specialist responsible for overseeing the optimal implementation of the IDSR strategy at the national level was interviewed. From the Directorate for Policy and Planning, a Monitoring and Evaluation (M&E) Officer was interviewed. The M&E officer is responsible for health information and management of all monthly health indicators (including those concerning infectious diseases that are covered by IDSR) that are submitted through the DHIS II by all District Health Management Team Offices country wide. At the provincial level, the study had sampled one key informant from the disease surveillance unit which is responsible for all disease surveillance activities in the province as well as receiving and compiling weekly IDSR reports from all districts under its jurisdiction. This unit is responsible for instituting and leading disease outbreak investigation efforts in the province. These responsibilities are the same for the district surveillance unit – though restricted to within district boundaries. At each of the two sampled DHMTs, two key informants were sampled; one officer from the health information unit; and the other from the disease surveillance unit. The health information unit is responsible for the collection, management, analysis and dissemination of health data on both communicable and non-communicable diseases as well as on risk behaviours that are of public health concern within the district. The health information unit is also responsible for receiving and compiling monthly reports on selected notifiable infectious diseases and other indicators ranging from service delivery to drug usage at health facilities under their jurisdiction in the district. At the sampled health facilities with an in-house laboratory, two key informants were purposively sampled; the Laboratory Officer-in-Charge and the Medical/ Nursing Officer-in-Charge. The Laboratory Officer InCharge is responsible for all laboratory related activities at the health facility and for entering information about detected diseases in the laboratory register as well as on a weekly and monthly basis to compile and submit reports on tested and/or detected priority notifiable infectious diseases at the health facility to the Medical Officer/Nursing in – Charge. Coupled with the day to day administration of the health facility, the Medical/Nursing Officer-in-Charge is responsible for compiling and submitting weekly and monthly reports on suspected, confirmed and mortality cases on priority notifiable infectious diseases seen at the health facility to their respective DHMTs. All in all, a total of thirteen health workers that were eligible and consented to participle in this study were interviewed.

Data collection

Data collection was conducted between January and March 2016. Interview guides were used in collecting data from the selected key informants. The study had four separate but related interview guides for each of the selected key informants. These interviews guides were for the following key informants: I) national, provincial and district surveillance officers; II) national and district information officers; III) Medical/Nursing Officers-in-Charge; IV) Laboratory Officers-n-Charge. The questions in the interview guide were adapted from the World Health Organisation (WHO) Protocol for the Assessment of National Communicable Disease Surveillance and Response Systems [20] and the Communicable Disease Surveillance and Response Systems: Guide to Monitoring and Evaluating [21]. The interview guides were developed and administered by the main author. The duration of the interviews ranged between 30 and 60 min. Each interview was recorded on a digital recorder. The principal investigator also took notes during the interview process. At the end of each interview, a typed transcript was then developed from the audio of the interview.

Data analysis

Thematic analysis approach was used to aid the data analysis process. This study utilised the deductive technique of qualitative data analysis [22]. This was done by predefining or identifying four major themes of the study. These themes were based upon the four components of the IDSR implementation strategy namely; structure; quality attributes; core functions and support functions [12, 21]. The sub-components of each of these four major components of the IDSR were treated as subthemes of the study. The themes that were falling outside the predefined analysis criteria were labelled and categorised separately. The coding and analysis of the collected data was done by the main author with oversight from the co-authors.

Ethical considerations

Ethical approval was necessary due to the fact that, the study involved human subjects and required asking them about their experiences. In-depth interview guides were used in this study, this raised the risk of the participants delving into personal and politically sensitive matters, hence the need to protect the study participants from these vulnerabilities by seeking ethical approval. Ethical approval for this study was obtained from the University of Zambia Biomedical Research Ethics Committee (UNZABREC) assurance No. FWA00000338 IRB00001131 of IORG0000774. Permission from the Permanent Secretary at the Ministry of Health (the chief administrator of the ministry) and the National Health Research Authority were obtained to conduct data collection within the Ministry. Informed consent was obtained from all participants prior to conducting the interview.

Results

Given the fact that the IDSR strategy is broad as it covers a wide array of activities that are supposed to be effectively implemented to achieve the ultimate goal of timely infectious disease detection and prevention and due to limited time and space, in this study, the researchers purposively selected certain key areas from each of the four components of the IDSR strategy that the researchers felt would to some extent highlight some of the main challenges of implementing the IDSR strategy within the Zambian health system. While the researchers acknowledge the fact that the studied areas of the IDSR strategy in this paper may not be incredibly extensive, it is believed that the findings (based on the selected IDSR strategy implementation areas) do highlight some (not all) of the prevailing challenges in the implementation of IDSR strategy that are ultimately contributing to the high rates of morbidity and mortality cases associated with priority infectious diseases such as Typhoid Fever and Measles in Zambia. The selected key areas of implementation are presented in Table 1 below.

Legal and regulatory framework

IDSR implementation in Zambia is governed by the Public Health Act of 1995, the IDSR technical guidelines, and the International Health Regulations of 2005. Most participants felt that the Public Health Act of 1995 was adequate to govern the effective implementation of the IDSR in the province, although there was a general sentiment that the existing legal and regulatory frameworks were not adequately responding to the current IDSR implementation environment. One key informant had argued that the Public Health Act of 1995, in particular, was not properly aligned with the International Health Regulations of 2005 to which Zambia is a signatory. While the Act covers a broad area of notifiable infectious diseases, it was seen to be weak in providing a legal framework that would be necessary to govern the detection, management and prevention of emerging and re-emerging infectious diseases and events of public health concern that is, H1N1 virus, Zika virus, bioterrorism which are not specifically covered by the Act. The following are some of the perspectives key informants had offered with regard to whether the Public Health Act of 1995 in its current form was adequate enough to provide a legal environment that would bring about an effective and efficient implementation of the IDSR strategy:

“… all issues of prevention, reporting of cases, events and conditions exist within the Public Health Act of 1995 specifically under the section for notifiable diseases and most of the notifiable diseases are the Mandyata et al. BMC Public Health (2017) 17:746 Page 5 of 12 IDSR diseases, only that this time around decision (parameters) have been changed. When you look at the International Health Regulations of 1969 and the International Health Regulation of 2005, they are no longer mentioning that this disease or that disease, instead they are saying any case, condition or event that is unusual or is of international public health concern should be reported”. (Key Informant MoH Headquarters) “I do not think they are because you cannot just have one regulation or document that is a guiding principle for the entire implementation of the IDSR. If you look at the Technical Guidelines for the IDSR, you will see that actually, they is a lot that is involved and may be if we can have back up of some other laws, then it will be easier”. (Key informant LPHO)

Core functions

Case detection

The study findings revealed that at the LPHO, the log of rumours and suspected outbreaks (used to track the time taken between the first-time rumours and/or suspected outbreaks were recorded and the time action was taken) was non-existent, instead, they relied more on the notification reports. When asked if they have a log of suspected outbreaks, events and rumours, one participant at district level had this to say:

“A log, we do not have, but we only have reports of rumours investigated, outbreaks investigated and so on. Any rumour that we hear we always investigate/ follow ups”. (Key Informant – DHMT)

Our findings also revealed that none of the four (4) health facilities that were visited in Chongwe and Lusaka districts had copies of the Zambian Technical guidelines on IDSR, although most of them had copies of the Standard Operating Procedures. The Technical guidelines on IDSR do provide stipulations on the procedures of handling suspected cases of a priority notifiable infectious disease at the facility level. Availability of these guidelines especially at the clinical level and their effective implementation at that level is the foundation of a strong disease surveillance system particularly in the early detection of priority notifiable infectious diseases and events of public health concern. However, what this study has found is that currently there is a challenge in ensuring that the simple procedures of that is, recording and investigating any rumour of a suspected disease or events of public health concern, promptly recording, reporting and obtaining laboratory confirmation of any suspected priority notifiable infectious disease, and optimal utilisation of the IDSR technical guidelines at all levels of IDSR implementation was inconsistently being done.

Case confirmation

Our findings revealed that the two laboratories that were visited had the capacity to test for notifiable infectious diseases such as; Dysentery, Malaria, HIV and Tuberculosis (TB) or those diseases that can be ascertained by simple serological tests. For those diseases that require more advanced laboratory techniques such as culturing, whenever they are suspected, samples have to be collected and sent to the few existing referral laboratories dotted around the country with the largest one being the central laboratory at the University Teaching Hospital in Lusaka. Cooler boxes are used to transport the collected samples to the referral laboratories. What our study results revealed was that, there is a time delay in most lower health facilities that is, urban and rural health centres between the time a priority notifiable infectious disease such Typhoid Fever is suspected and the time it is confirmed at the referral laboratories (and communicated back to the health facility that sent the samples) and the time appropriate treatment is instituted on the affected patients. And this is attributable to the suboptimal laboratory capacities at most district hospitals as well as urban and rural health centres to confirm diseases that require culturing techniques and the fact that the referral laboratories where some of these tests can be done are usually hundreds of kilometres away. In terms of water supply, both laboratories had consistent supplies; each health facility had at least one borehole as a water source coupled with supplies from the Lusaka Water and Sewerage Company. This study further found that only the T – lymphocyte cell bearing CD4 receptor (CD4) machines were connected to the backup power generators at both laboratories. The study also found that the supplies of reagents and other laboratory materials from Medical Stores was relatively consistent although they would be some months when supplies would be erratic especially when the suppliers did not have the materials that have been requested for.Supply of new laboratory stock is also dependent on monthly reports submitted to Medical Stores. One key informant had the following to say on the consistency of the central Medical Stores in providing the necessary

materials to the laboratories at the visited health facilities:

“…not very good because at times you find that some of the things we ordered if they do not have they don’t supply. But for HIV test kits they are very consistent… At times, they could be one or two or three months when they could be challenges with the supply. Basically, what you report is what you get. The supply chain is report dependent. The supply of laboratory material is dependent on the report”. (Key Informant – Chongwe health facility)

Case registration

Case registration In terms of registration of every case that is seen at the health facility, the study found that in some health facilities particularly those with a high patient demand clinicians are failing to comprehensively enter the appropriate information in the tally sheets, disease aggregation forms and other patient information collection documents available within their offices of operation. One of their arguments as one of the participants (Key Informant DHMT) put it is that: “I see a lot of patients, tallying [of cases seen on each day] will delay my work”. Key informants also indicated that the situation was also similar in those health facilities which at most times have low patient demand, thus clinicians have much more time on their hands. However, even in these kinds of health facilities (ones with low average daily patient demand) clinicians simply are not willing to consistently and completely enter and tally information about the cases that they come across at their respective health facilities on each particular day they are on duty. We further found that, in order to work around this challenge of not tallying complete information about cases seen, some health facilities have been engaging data clerks who on a weekly and monthly basis go through each of the patient’s books, disease aggregation forms, patient and laboratory register entries and/or other patient documents to extract information to be reported to the respective DHMT by Monday or the first working day of the following week for the weekly IDSR reports and by the 7th of the following month for the monthly surveillance reports on priority notifiable infectious diseases. It was also found that even where they are data clerks available to extract the priority notifiable infectious disease surveillance data from the various patient documents and registers, the illegibility of most clinicians’ handwriting is proving to be a barrier to their ability to extract correct information. In some instances, the actual diagnosis as determined by the clinician may not be clear, hence in such situations, the data clerks then have to look at the prescription to determine and sometimes guess the actual diagnosis, due to the illegibility of the attending clinician hand writing. Thus, even when surveillance counts are sent to the respective DHMT on a weekly and monthly basis, the counts may not be the actual representation of the cases seen for that particular period (reporting week or month):

“This means that data is missing, and it is missing because the clinicians are overwhelmed [by the high patient demand] and they have no time to tally all the cases that they see. Equally, the clerks are also overwhelmed because of the huge number of patient books and other materials from which they are supposed to uplift data from and make a weekly and monthly report. So, at the end of the day, they just do what they feel they should do”. (Key Informant – DHMT)

Case reporting

Once the weekly number of suspected and confirmed cases seen at the particular health facility have been tallied, they are entered in the standardised reporting forms provided by the respective DHMT offices. Health facility laboratories were available also make reports on the number of samples they have sent to the referral laboratories within a particular week. In instances whereby they are more than average numbers of cases that are being seen at a particular time, a line list is also used to collect information about the cases that are being attended to and these are sent together with weekly and/or monthly surveillance reports. Note that, the DHMTs only receives reports from health facilities under their jurisdiction and the largest facility at the district level is the district hospital – a level one hospital. General, central and teaching hospitals are not supervised by the DHMTs within the district where they are located but are supervised by the Ministry of Health (MoH). Although, these larger hospitals are expected to report any suspected, confirmed and mortality cases associated with priority notifiable infectious cases to the DHMTs from where the disease was originating from (i.e. patient resides in Ndola district in the Copperbelt province but was diagnosed in Lusaka district in Lusaka Province) they usually do not unless the designated district surveillance officer requests for the information. Once, the DHMTs receive the weekly reports from the respective health facilities and upon cleaning the data sent, they also tally the surveillance data received and submit a weekly IDSR report to the Provincial Disease Surveillance Officer at the Provincial Health Office (PHO). In most cases, when the DHMTs are sending Mandyata et al. BMC Public Health (2017) 17:746 Page 7 of 12 weekly IDSR reports to the PHO they also attach copies of notification reports (which highlight preliminary background information about the affected patient[s]) which are compiled by health facilities. However, what this study found is although these notification reports are much more detailed than the IDSR reports, they are not treated as disease surveillance reports themselves. Only the aggregated information in the weekly IDSR reports is treated as disease surveillance data. The information they provide (notification reports) is only used to aid the suspected notifiable infectious disease outbreak investigations. Note that the IDSR reports submitted to the DHMTs, PHOs and MoH headquarters only highlight total counts of suspected, confirmed and mortality cases seen in that particular week. Key variables such as age, gender, the area of residence, date of first attendance, types of samples collected are not included in the reports. The variables found within the notification where they are reported according to a key informant at the Lusaka Provincial Health Office include such things as:

“Age, gender, place of residence, occupation, date of first attendance, phone numbers, next of kin, specimen that were taken, whether or not they were confirmed, the actual diagnosis among other things. It also contains the historical background for that particular patient and whether or not the patient had died and what was done after that, recommendations and conclusion are also provided.” (Key Informant – LPHO).

Note that, the information that is contained within the notification reports is not the information that is entered in the Excel worksheets (treated as databases) at the DHMTs and PHOs. Only information that is contained in the weekly IDSR reports is entered in the Microsoft Excel work sheets. The other challenge we found was that (at the time of the study), the weekly IDSR reports had not yet been fully incorporated in the DHIS II for reporting to the next level. This is despite the fact that, the Ministry of Health rolled out the DHIS platform as far back as 2007 and around 2012, the Ministry upgraded the system to DHIS II. As a result, weekly reports are sent to the next level through phone calls, email and sometimes through the delivery of hard copies on a weekly basis:

“The [weekly] surveillance data is not sent through the DHIS II. The disease surveillance unit have their own database [Microsoft Excel Worksheets] – created by the surveillance unit. They compile a weekly report and submit it through email on a weekly basis. For those who are unable to email, they have hard copies that are blank which they fill in on a weekly basis. ” (Key Informant – LPHO).

This study also found that there is a parallel and wellestablished reporting structure for the monthly notifiable infectious disease surveillance reports which are sent to the M&E unit (under the Directorate for Policy and Planning) through the use of the DHIS II. This system is available currently at the district level, however, it is not yet available at the health facility level. On a monthly basis, health facilities tally all information about suspected and admitted cases of all notifiable infectious diseases as well as their associated mortalities that they had seen during that month. This information has to be submitted to the DHMT by the 7th day of every month. Once the information has been validated at the district level, the DHIO now enters this information in the DHIS II which makes the information instantaneously available to anybody who has access to the system. This information should be entered in the system by the 21st of every month. Thus, there is a 14-day delay between the time DHMTs receive monthly surveillance counts from the respective health facilities and the time this information is entered in the DHIS II:

“Before the data is even entered …, you check through the facility reports. If you find that there are issues you can even retain the report to the facilities for them to read through. Then it can be resent. But of course, the person who is sending the data may not be able to check through every indicator. So, certain indicators, you will find that they are okay while in others they may be some lapses…” (Key informant – DHMT)

Surveillance data analysis

Our study findings revealed that the weekly IDSR reporting form does not have the person (that is, age and gender) and place (that is, residential area) variables, only aggregate figures are provided in the report. The findings showed that the main form of analysis conducted is through the construction of trend lines and/or disease monitoring charts as recommended by MoH (see [23]). Each reporting surveillance officer either from the DHMTs reporting to the Provincial Health Offices or this reporting to MoH headquarters gives a brief analysis and discussion of the figures that they had received in the previous week and/or month. When asked whether or not weekly trend and disease monitoring charts, as well as trend lines, were being consistently constructed one key informant had the following to say:

“…we do that, but on a quarterly basis but it’s not like every day or every week but from our data, we are able to see that Measles, for example, is coming down or it’s going up. Once we see that it is going up or down we notify the next level. ” (Key informant –

LDHMT)

Microsoft Excel is used to tally and analyse the received weekly IDSR reports while in most cases the statistical functions available in the DHIS II are normally used to analyse the monthly disease surveillance reports. Advanced statistical software such as Stata, SPSS and so on are used only in times when they need to do some further digging on the data. Surveillance data has to be analysed by person and time as well as by place. One of the most accurate ways to analyse surveillance data by place is through the utilisation of the Geographical Information System (GIS). However, currently our findings revealed that this tool (GIS) is not being utilised in aiding the accurate understanding of the precise geographical distribution of priority notifiable infectious diseases in the country:

“We used to have what is called the health mapper, [for] GIS… what you should bear in mind is that we do not have a system now that is in a sharp we would have loved it too. But when we had EPI info system, mapping was provided, meaning that you can do (analyse) your data and show it. Even at this (national) level, we were able to analyse and show which district and in which province or which province has a particular disease. If we wanted to particularise to a district we would be able to paint the districts that are affected. If we wanted to show which health facilities within the particular district where the cases were coming from, we were able to show those health facilities.” (Key informant – MoH Headquarters)

Response and control The study findings revealed that at the provincial and district levels, the Rapid Response Teams (RRTs) have been created and includes such specialised officers such as the: Disease Surveillance Officers, clinical care experts, nursing officers, environmental health officers, transport unit, and laboratory unit:

“…as a province, we have a Rapid Response Team [RRT]. This RRT will first do an on-spot check of the data that was sent. For example, if it is Typhoid Fever or Cholera that has been reported, we will go there as a team to investigate and verify what they [DHMTs] have sent. Then if they is need to support them materially, then we do that. But usually what is there is that we have logistics and supplies that are set aside for such things. So, if they [DHMTs] need any further support from the provincial health office that is, financially or materially then we come in to help.” (Key informant – LPHO).

Feedback Validated and analysed disease surveillance counts on specific priority notifiable infectious diseases is disseminated (feedback) back to the lower levels of the implementation hierarchy as highlighted by the arrows pointing downwards in Fig. 1 above. Feedback is provided through quarterly or annual reports, statistical bulletins, supervisory visits, newsletters, workshops and seminars. However, this study found that feedback to the lower implementation levels was not being done in a consistent manner – that is, the Provincial Health Offices sending feedback to respective DHMTs and from these to the health facilities and then finally to the communities. Participants indicated that feedback is at most times provided when the senders have done something wrong that is the presence of errors in the report, have sent higher or lower than usual numbers of suspected and/or confirmed priority cases or during the times of a disease outbreak:

“It is usually when there is something wrong that is when you get that feedback. And also, when you have a meeting and you present your data that is when you will hear some comments on your data. But not immediately that somebody views your data, and gives you feedback. ” (Key Informant DHMT). “[with regard to us] sending data [feedback] to the health facilities we have not been doing that, but we are supposed to do it. But what we do normally is that when we see some strange disease trend from some of our reporting facilities, we call them – we notify them. ” (Key Informant DHMT).

Support functions Training Key informants especially those at the periphery levels revealed that they have not yet been trained in IDSR although they have a primary role in the implementation of the strategy within their respective districts. The main reason that was given was that these trainings are expensive and at most times there is usually no funding specifically for training in IDSR. In instances where health workers are trained in most cases, it is just an orientation to the system especially for the newly recruited health staff:

“…remember this thing came with donor funding – but what is there now is that where we see gaps we just do an on-site orientation. For example, if we see that a particular DHMT is not doing fine in terms of reporting we do an onsite orientation there and then just to impart knowledge on the IDSR.” (Key informant – LPHO)

Logistical support

In terms of logistical support, we found that transportation facilities, particularly at district and facility levels, was the major challenge. At the district level, the unit responsible for district surveillance in most cases has to rely on pool vehicles to conduct its activities as they do not have Mandyata et al. BMC Public Health (2017) 17:746 Page 9 of 12 their own transport facilities. At the facility level, the challenge is even deeper. Due to the general lack of transports facilities, health workers in some cases have to use their own initiative in order to transport samples to referral laboratories for disease confirmations – sometimes at their own costs. Where they can, the core implementers (Ministry of Health Headquarters and Provincial Health Offices) do provide logistical support to the respective DHMTs and their respective health facilities:

…transportation is one of the biggest challenges affecting our work here at the district. If we as a unit can have our own transport instead of relying on pool vehicles [it] would make our work much easier. (Key Informant DHMT)

Supervisory visits, monitoring and evaluation

Our study findings revealed that supervisory visits were not being done in a regular manner and that it is usually only in times of disease outbreaks that is when supervisory visits to the periphery levels are done. One of the main reasons cited was the lack of funding from Central Government for such activities. Furthermore, a clinician interviewed revealed that supervision would at times be conducted when they (clinical staff ) visited their respective District Health Management Team offices:

“Supervisory activities are not done due to funding. For 2015 only one was done [at a provincial level.” (Key informant – LPHO).

Quality attributes

Representativeness of IDSR surveillance data

The findings from this study have revealed that so far most of the weekly and monthly IDSR data that is reported to the DHMTs is mostly from the public health facilities. DHMTs are still struggling to get the private health facilities to submit the weekly and monthly IDSR reports despite several attempts requesting them to send reports regardless of whether or not they have had a case of a priority notifiable infectious disease:

“Majority of the health institutions that submit the weekly reports are the public health centres. However, we are still struggling to incorporate the private health facilities, we have had meetings with these institutions but for them to send data here they are finding it a problem. But for a few like Lusaka Trust Hospital whenever they have a case that is notifiable, they call, they have my number and we go there and collect information and then we disseminate to the relevant authorities.” (Key Informant – DHMT).

IDSR system stability

Stability here refers to the duration and consistency of operation of the system [24]. This study also tried to gauge the stability of certain aspects of the IDSR system by asking the key informants to give an estimate on the frequency of internet outage that they experience in a specified period of time – in this case, six months (this is relevant as a bulk of communication between the different IDSR implementation levels is done via the internet). Most of the key informants had indicated that they experience internet outage when; power supply to their offices has been cut mostly due to load-shedding; subscription fees to the service providers have not been paid by the respective health offices; and at times even when there is internet connectivity, it often is so slow that officers cannot download or upload files either through their emails addresses or through the DHIS II in a timely manner. In order to ensure that reports are sent on time, most officers at the periphery as well as at the core of the IDSR system resort to the use of their personal internet access mostly through their mobile phones at their own cost:

“In most cases, there is internet only when they is power, however, we are heavily load-shaded here at the office. Hence, in most of the cases, we have to rely on our own internet mostly through mobile phones … for districts the situation is quite bad. Since most of them depend on their grants to pay for such services as internet connectivity … at the moment, grants are a bit erratic, there isn’t much funding from the central government. Worse even at the centre level, for they just use their own initiative to send these reports”. (Key Informant – LPHO)

Discussion

The study has shown that the Ministry of Health has made significant strides in the adaptation and implementation of the IDSR strategy to the Zambian context. The strength of the system is that it has been rolled out to all health facilities throughout the country. The technical guidelines for IDSR in Zambia make it explicit that all health facilities public or private have to report all suspected, and confirmed mortality cases associated with any of the priority notifiable infectious diseases stipulated within the guidelines and the Public Health Act of 1995. The guidelines even go further by requiring all health facilities to submit weekly and monthly reports on selected priority notifiable infectious diseases regardless of whether or not they have had a case. The Ministry has also established an IDSR implementation structure with clearly defined roles and responsibilities for each position from national to facility level. There is also a dedicated budget plan for IDSR implementation Mandyata et al. BMC Public Health (2017) 17:746 Page 10 of 12 which is revised on a regular basis. However, despite these strengths, they are still gaps that are hampering the optimal implementation of the strategy. On the core functions side of the strategy, the ministry is still facing challenges in the effective detection, registration and reporting of cases to the higher levels. While these challenges emanate from a multi-facet of sources, health workers’ attitude, inadequate and ill-trained human resources (in IDSR), high patient demand, several reporting requirements, inadequate availability of necessary materials and tools, and poor information and communication technology infrastructure are directly contributing to the dismal performance of the system [7, 25, 26]. Health worker motivation, especially at district and facility levels, was particularly negatively impacted by the inadequacy and inconsistency feedback that is provided to the lower levels. Health workers are not adequately informed on their performance concerning the tallying and submission of weekly and monthly disease surveillance counts and how their efforts are contributing to the fight against priority notifiable infectious diseases in the community where they work. The study has also shown that it is not only the lack of feedback that is affecting the optimal performance of the system in detecting, preventing and controlling notifiable infectious diseases but also the health workers lack lustre attitude towards recording, tallying and reporting of all cases that they see at their respective health facilities. While the poor enforcement of the Public Health Act, technical guidelines on IDSR and other regulations are some of the contributors to this negative attitude, the heavy leaning of the general health system in Zambia towards curative medicine at the expense of preventive medicine through public health and the high patient to medical personnel ratio are other contributing factors. Weaknesses in providing appropriate technical support especially transportation and communication facilities are also significantly contributing to the inability of the health workers particularly at district and facility levels to adequately carry out their assigned IDSR implementation duties. These facts were found to be re-enforcing the sub-optimal performance of the other areas of the core functions that is, case registration, reporting, analysis and response, and control. Consistent feedback coupled with other incentives (that is improved technical support) and disincentives for defaulters was found to significantly contribute to improvements in the quality, timeliness and completeness of reporting of monthly and weekly disease surveillance reporting in Peru and Tanzania [25, 27]. Sub-optimal performance of the core function side of the strategy was also re-enforced by poor implementation of the support side of the strategy [28, 29]. Training of key front line staff on IDSR was still inadequately being done. At the same time, the technical guidelines on IDSR implementation in Zambia [17] are also not readily made available particularly at health facility level. Health workers mostly rely on their experiences and academic backgrounds in order to execute their duties with regard to IDSR – which may not be adequate as disease surveillance is not specifically offered as a course in medical colleges and universities in the country. This is further having an impact on the quality and quantity of the disease surveillance data that is being generated, transmitted and utilised for decision making in the Zambian health system. The higher the number of key frontline staff trained in IDSR, the higher the reported improvements in the quality of reporting, feedback, supervision, monitoring and evaluation including timeliness and completeness of reporting in the health systems of Cape Verde, Eritrea, Ethiopia, Guinea Bissau, Tanzania, South Sudan, Gambia, Uganda and Malawi [25, 30, 31]. Competent disease surveillance staff at all levels of health service delivery are a necessity especially in a resource limited country like Zambia for rational planning, implementation and infectious disease prevention and control [32]. These weaknesses coupled with other broader health system gaps that is the inadequate enforcement of the Public Health Act of 1995 [16] and other local and international regulations on health service delivery in Zambia, health financing, inadequate human resources, logistical and technical support and so on., are all reflected in the sub-optimal performance of the IDSR particularly on the quality attributes of timeliness and completeness of reporting as well as in the management of disease surveillance data at national level.

Conclusion

The Ministry of Health has over the years made significant strides in the quest to have a system that would specifically be used to detect, prevent and control priority notifiable infectious diseases in the country in the most effective and efficient manner. So far, the Ministry has put in place an IDSR implementation structure with clearly defined goals and measurable indicators. The ministry has also created dedicated disease surveillance positions, epidemic preparedness committees, and rapid response teams from national to district levels. However, a number of gaps still remain. These include inadequately trained human resources, lack of provision of optimal technical support to the DHMTs and health facilities, poor infrastructure and coordination challenges. For as long as these challenges remain unattended to, the number of preventable morbidity and mortality cases associated with priority notifiable infectious diseases in Zambia will continue to be high. It is, therefore, of utmost importance that the Ministry of Health comprehensively Mandyata et al. BMC Public Health (2017) 17:746 Page 11 of 12 addresses the challenges that have been raised in this study in order to improve decision making within the health system and to inform policy and ultimately, to effectively and efficiently detect, prevent and control priority notifiable infectious diseases in Zambia.

Abbreviations

AFP: Acute Flaccid Paralysis; CDHMT: Chongwe District Health Management Team; DHIO: District Health Information Officer; DHIS II: District Health Information System Version II; DHMT: District Health Management Team; EHO: Environment Health Officer; EVD: Ebola Virus Disease; HIV: Human Immunodeficiency Virus; HMIS: Health Management Information System; IDSR: Integrated Disease Surveillance and Response; IHR: International Health Regulations; LDHM T: Lusaka District Health Management Team; LPHO: Lusaka Provincial Health Office; M&E: Monitoring and Evaluation; MOH: Ministry of Health; PHO: Provincial Health Office; TB: Tuberculosis; UNZABREC: University of Zambia Biomedical Research Ethics Committee; WHO – AFRO: World Health Organisation Regional Office for Africa; WHO: World Health Organisation

Acknowledgements

Not applicable.

Funding

This study was not funded by any funding body

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding authors on reasonable request.

Authors’ contributions

CM conceptualized the study area, collected, analysed and interpreted the data and wrote the draft manuscript from beginning to end. LKO provided supervision, participated in the analysis and interpretation of the data as well as in the refining of the whole manuscript. WM provided guidance and supervision in the conceptualization, analysis and interpretation of the data as well as in refining the whole manuscript from beginning to end. All authors read and approved the final manuscript.

Ethics approval and consent to participate

This study was ethically approved by the University of Zambia Biomedical Research Ethics Committee assurance no: FWA00000338 IRB00001131 of IORG0000774.

Consent for publication

Not Applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

List of References

1. Brownson RC, Elizabeth AB, Leet TL, Gillespie KN, William R. True, Evidence Based Public Health. 2nd ed. Cape Town: Oxford University Press; 2011.

2. Thacker SB, Berkelman RL. Public Health Surveillance in the United States. Epidemiol Rev. 1988;10:164–90.

3. Buehler JW. In: Rothman KJ, Greenland S, Lash TL, editors. Surveillance, in Modern Epidemiology. Philadelphia: Lippincott

Williams & Wilkins; 2008.

4. Elida M. Evaluation of Surveillance Systems of Infectious Diseases and Vaccination Coverage in Albania. Milan Universita Degli Studi Di Milano;

2011. p. 219.

5. Serrano PEM. Spatial and Spatiotemporal Methods for Public Health Surveillance. Valencia: University of Valencia; 2012. p. 157.

6. Calain P. From the Field Side of the Binoculars: A different view on global public health surveillance. Health Policy Plan. 2007;22(1):13–20.

7. Franco LM, Setzer J, Banke K. Improving Performance of IDSR at District and Facility Levels: Experiences in Tanzania and Ghana in Making IDSR Operational. Maryland: Abt Associate, Inc; 2006.

8. Lukwago L, et al. The Implementation of Integrated Disease Surveillance and Response in Uganda: a review of progress and challenges between 2001 and 2007. Health Policy Plan. 2012;28(1):30–40.

9. Nsubuga P, et al. Structure and Performance of Infectious Disease Surveillance and Response, United Republic of Tanzania, 1998. Bull World

Health Organisation. 2002;80(3):196–203.

10. Nsubuga P, et al. Public Health Surveillance: A tool for targeting and monitoring interventions. In: Jamison DT, et al., editors. Disease Control

Priorities in Developing Countries. Washington (DC): Oxford University Press and The World Bank; 2006. p. 1394.

11. Phalkey RK, et al. Assessment of the Core and Support Functions of the Integrated Disease Surveillance System in Maharashtra, India. BMC Public Health. 2013;13(575):575.

12. WHO and CDC. Technical Guideline for Integrated Disease Surveillance and Response in the African Region. Brazzaville: World Health Organisation; 2010.

13. WHO. International Health Regulations (2005). Geneva: World Health Organisation; 2005.

14. Baker MG, Fidler DP. Global Public Health Surveillance Under New International Health Regulations. Emerg Infect Dis. 2006;12(7):1058–65.

15. MoH. Annual Health Statistical Bulletin. Lusaka: Ministry of Health, Zambia; 2012.

16. Parliament of Zambia. Public Health Act. Lusaka: National Assembly of Zambia; 1995.

17. MoH. Technical Guidelines for Integrated Disease Surveillance and Response in Zambia. Lusaka: Ministry of Health, Zambia; 2011.

18. Mutale W, et al. Improving Health Information Systems for Decision Making

Across Five sub-Saharan African Countries: Implementation strategies from the African Health Initiative. BMC Health Serv Res.

2013;13 Suppl 2:S9.

19. Central-Statistical-Office. In: C.S. Office, editor. Zambia 2010 Census of Population and Housing. Lusaka: Central Statistical Office; 2012. p. 406.

20. WHO. Protocol for the Assessment of National Communicable Disease Surveillance and Response Systems. Geneva: World Health Organisation; 2001.

21. WHO. Communicable Disease Surveillance and Response Systems: Guide to Monitoring and Evaluating. Geneva: World Health Organisation; 2006.

22. Williams AC, Bower EJ, Newton TJ. Research in Primary Dental Care Part 6: Data Analysis. Br Dent J. 2004;197(2):67–73.

23. USAID and T.O. Deliver Project. Digging into Malaria Data: Comparing HMIS and LMIS Data to Improve Program Management in Zambia. Arlington: USAID & Deliver Project; 2011.

24. MMWR. In: E.P. Office, editor. Updated Guidelines for Evaluating Public Health Surveillance Systems: Recommendations from the Guidelines

Working Group. Atlanta: Centers for Disease Control and Prevention (CDC), U.S. Department of Health; 2001. p. 51.

25. Gueye D, Senkoro KP, Rumisha SF. Baseline Monitoring and Evaluation of Integrated Disease Surveillance and Response in Tanzania, October – December 2003. Bethesda, MA: The Partners for Health Reformplus Project and Abt Associates Inc; 2005.

26. Mtemba ZJ. Integrated Disease Surveillance and Response Systems in Resource-limited Settings. Glasgow: University of Glasgow; 2013. p. 124.

27. Huaman MA, et al. Impact of two Interventions on Timeliness and DataQuality of an Electronic Disease Surveillance System in a Resource Limited Setting (Peru): A prospective evaluation. BMC Med Inform Decis Mak. 2009;9(16)

28. Mavimbe JC, Braa J, Bjune G. Assessing Immunization Data Quality From Routine Reports in Mozambique. BMC Public Health. 2005;5

29. Phalkey RK, et al. Challenges with the Implementation of an Integrated Disease Surveillance and Response (IDSR) System: A systematic review of the lessons learned. Health Policy Plan. 2013;30(1):131–43.

30. Pond B, et al. Mid-Term of the Integrated Disease Surveillance and Response Project. Washington DC: USAID and Management Systems

International; 2011.

31. Sow I, et al. Trained District Health Personnel and the Performance of Integrated Disease Surveillance in the WHO African Region. East Afr J Public Health. 2010;7(1):16–19.

32. Narasimhan V, et al. Responding to the Global Human Resources Crisis. Lancet. 2004;363(9419):1469–72

 

Facebooktwittergoogle_pluslinkedinmail

Improving health information systems for decision making across five sub-Saharan African countries: Implementation strategies from the African Health Initiative

Wilbroad Mutale1,2*, Namwinga Chintu1 , Cheryl Amoroso3, Koku Awoonor-Williams4, James Phillips5Colin Baynes5,6, Cathy Michel7, Angela Taylor1, Kenneth Sherr8

1. Centre for Infectious Disease Research in Zambia, Zambia.

2. School of Medicine, University of Zambia, Zambia.

3. Partners In Health/Inshuti Mu Buzima, Rwanda.

4. Upper East Regional Health Directorate, Ministry of Health, Ghana.

5. Heilbrunn Department of Population and Family Health, Mailman School of Public Health, Columbia University, NY, USA.

6. Ifakara Health Institute , Mikocheni, Dar-es-Salaam, Tanzania.

7. Health Alliance International, Direcçao Provincial de Saúde, Beira, Sofala, Mozambique.

8. Department of Global Health, University of Washington, Seattle, USA.

Download PDF

Correspondence: Wilbroad Mutale (wmutale@yahoo.com)


Citation style for this article: Mutale W, Chintu N, Amoroso C et al.Improving health information systems for decision making across five sub-Saharan African countries: Implementation strategies from the African Health Initiative. Health Press Zambia Bull. 2018;2(12); pp 4-16. This work has been adapted from the original article “[ Improving health information systems for decision making across five sub-Saharan African countries: Implementation strategies from the African Health Initiative]” by [Wilbroad Mutale, Namwinga Chintu, Cheryl Amoriso, Koku Awoonor-Williams, James Phillips, Colin Baynes, Cathy Michel, Angela Taylor, Kenneth Sherr and with input from the Population Health Implementation and Training – Africa Health Initiative Data Collaborative]. BMC Public Health Services 2013, 13(Suppl 2):S9 (https://doi.org/10.1186/1472-6963-13-S2-S9; https://bmchealthservres.biomedcentral.com/articles/10.1186/1472-6963-13-S2-S9). The original article is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


Weak health information systems (HIS) are a critical challenge to reaching the health-related Millennium Development Goals because health systems performance cannot be adequately assessed or monitored where HIS data are incomplete, inaccurate, or untimely. The Population Health Implementation and Training (PHIT) Partnerships were established in five sub-Saharan African countries (Ghana, Mozambique, Rwanda, Tanzania, and Zambia) to catalyze advances in strengthening district health systems. Interventions were tailored to the setting in which activities were planned.

Comparisons across strategies:

All five PHIT Partnerships share a common feature in their goal of enhancing HIS and linking data with improved decision-making, specific strategies varied. Mozambique, Ghana, and Tanzania all focus on improving the quality and use of the existing Ministry of Health HIS, while the Zambia and Rwanda partnerships have introduced new information and communication technology systems or tools. All partnerships have adopted a flexible, iterative approach in designing and refining the development of new tools and approaches for HIS enhancement (such as routine data quality audits and automated troubleshooting), as well as improving decision making through timely feedback on health system performance (such as through summary data dashboards or routine data review meetings). The most striking differences between partnership approaches can be found in the level of emphasis of data collection (patient versus health facility), and consequently the level of decision making enhancement (community, facility, district, or provincial leadership).

Discussion:

Design differences across PHIT Partnerships reflect differing theories of change, particularly regarding what information is needed, who will use the information to affect change, and how this change is expected to manifest. The iterative process of data use to monitor and assess the health system has been heavily communication dependent, with challenges due to poor feedback loops. Implementation to date has highlighted the importance of engaging frontline staff and managers in improving data collection and its use for informing system improvement. Through rigorous process and impact evaluation, the experience of the PHIT teams hope to contribute to the evidence base in the areas of HIS strengthening, linking HIS with decision making, and its impact on measures of health system outputs and impact.

Background:

Health Information Systems (HIS) are one of the six essential and interrelated building blocks of a health system. A well-functioning HIS should produce reliable and timely information on health determinants, health status and health system performance, and be capable of analyzing this information to guide activities across all other health system building blocks [1]. Thus, an HIS enables decision-makers at all levels of the health system to identify progress, problems, and needs; make evidence-based decisions on health policies and programs; and optimally allocate scarce resources [2-4] – all of which are key elements in the success of large-scale efforts to achieve health improvements [5]. Weak HIS are a critical challenge to reaching the healthrelated Millennium Development Goals [6,7]. Evaluations of routine health facility data have identified consistent problems in HIS completeness, accuracy and timeliness in low- and middle-income country (LMIC) health settings [8,9], which limit HIS use for routine primary health care (PHC) planning, monitoring, and evaluation [10-12]. Other factors associated with poor quality data in resource constrained settings include duplicate, parallel reporting channels and insufficient capacity to analyze and use data for decision making [13]. Improving HIS functioning is a priority given its central role in the delivery of equitable and high quality health services, though approaches to improving HIS vary. Simple data quality assessments that engage frontline health workers and data managers have been used to verify, standardize, and improve routine HIS data [14-16]. Other approaches have focused on technological interventions such as information communication technologies (ICT) designed to reduce errors through reducing data bulkiness and automating data collection, validation, and analysis [4,17,18]. To ensure that HIS contribute to improved health services, it is essential that policy makers and health system managers utilize available information for ongoing monitoring of plans and programs, as well as for resource allocation purposes. Information management is a basis for the production of knowledge and its translation for health system decision making [19-21]. Further evidence is needed on effective strategies for linking data system improvements with decision making, including its impact on the delivery of health services and population health. The Doris Duke Charitable Foundation launched the African Health Initiative to catalyze significant advances in health systems strengthening through supporting Population Health and Implementation Training (PHIT) Partnerships in five sub-Saharan African countries (Ghana, Mozambique, Rwanda, Tanzania and Zambia) [29]. All five PHIT Partnerships include approaches to strengthen the HIS building block as a means of improving health service delivery and, ultimately, population level health. Despite the common goal of improving data capture to support timely decision making, each partnership uses project-specific strategies to strengthen HIS and improve decision making and to target different levels of the health system, including health managers, clinicians, and the community. The full description of each partnership’s methodology is described elsewhere [30-35]. This paper describes, compares, and contrasts the five PHIT Partnership approaches to strengthen HIS and promote the use of data for decision making, focusing on the designs, activities, and the adaptations during the implementation process.

PHIT Partnership approaches to improve HIS and decision making

Table 1 summarizes the range of models to improve HIS across the five PHIT countries, focusing on integration approaches with the MOH’s HIS, strategies for improving data quality, procedures for handling and manipulating data, strategies for linking data to decision making, and sustainability plans.

Ghana

The Ghana PHIT Partnership (the Ghana Essential Health Intervention Project, or GEHIP), has two intervention strategies to strengthen the HIS and link information with improved health system operations. The first is to implement a simplified information capturing system as part of the District Health Information Management System (DHIMS-2) that focuses on essential information for district level planning, thereby reducing the reporting burden in primary care settings (Figure 1). The second is the adoption of a District Health Planning and Reporting Toolkit (DiHPART) for use by district health leadership to identify and allocate resources based on the district level burden of disease profile.

Rationale and contextual appropriateness

Data capture for DHIMS-2

Simplified registers were introduced to standardize data sources, and to ensure consistent supply of registers for community health officers (CHOs). The simplified registers also allow health facilities to rapidly tally figures for monthly summary reports in order to address complex data capture responsibilities that occupied more frontline staff time than clinical service delivery [22]. Prior to the adoption of the simplified registers, maintaining patient encounter registers was complex and cumbersome, involving 27 register books to collect information on patient attendance at outpatient consults, maternity, well-child care, family planning, and home visits. Collating and reporting health information was particularly tedious for CHOs, who record, compile, and report client encounters to sub-district and district levels.

Planning and budgeting with DiHPART

Based on the observation that national decentralization policies lack appropriate training and tools for district leaders to base priorities on need, the DiHPART tool was developed to assist managers with planning. As a means of basing decision-making on known patterns of risk, DiHPART removes the guesswork from budgeting, simplifying the task of strategic leadership for health resource allocation.

Activities and feedback mechanism Data capture for DHIMS-2

The GEHIP team worked with district and sub-district managers and CHOs to review, redesign, and implement the improved versions of the simplified registers over a one-year period. A detailed review was carried out to inventory baseline data collection (data fields collected, registers used), identify redundant information, and assess data collection for appropriateness and relevance for district health managers and CHOs. The physical size of the simplified registers was reduced to make them easier to carry during outreach activities. In the course of this iterative process, the simplified registers were piloted in one district and subsequently adapted to the need of all three GEHIP districts after feedback from CHOs and district health information officers. The data fields collected are regularly reviewed to keep them up to date with those collected by the Ghana Health Service. Procurement, distribution, and content revision functions have been fully integrated into the Upper East Regional Health Information Unit, which facilitates rapid adaptation, adoption, and continued use. In their final format, the simplified registers include five registers for CHOs to gather data on facility consults for outpatient, maternal and child care services, and outreach services in homes and schools. Although the initial goal was to develop a single register, delineation of functions within health facilities required five registers to collect clinical data when staff were deployed to outreach activities. To ensure data quality and its use, monthly and quarterly data validation meetings are held by CHOs, subdistrict, and district teams to review data collected and identify gaps. Subsequently, the data are compiled and submitted to the regional and national levels.

Planning and budgeting with DiHPART

DiHPART’s introduction included an orientation for district health management teams to provide an overview of the disease burden and its implications for current plans and activities, followed by identification of adaptations to align spending priorities with risk patterns. Disease burden models for DiHPART were based on cause of death data from locally derived data provided by the Navrongo Health Research Centre.

Adaptation and learning during implementation

Data capture for DHIMS-2

Qualitative appraisal of reactions to the simplified register system suggests that CHOs welcome the reduced documentation burden and additional time for service and outreach. Essential for the register simplification process has been coordination with national HIS reform (Figure 1), including streamlining data collection and aggregation operations (pathway A) , simplifying and computerizing feedback to all levels (pathway C), and enabling health workers to view data feedback and compare performance with counterparts (pathway D). GEHIP experience has identified additional areas for improvement. Efforts to use cell phone technology for data entry encountered technical problems. In addition, district and regional funds are insufficient to independently cover the recurrent supply cost, including CHO registers. This problem may be resolved when the simplified registers are adopted for nationwide implementation.

Planning and budgeting with DiHPART

The experience with implementing DiHPART has differed from expectations in multiple ways. The lack of flexible funds due to earmarked wages and donor requirements has led to a disconnect between DiHPART plans and actual expenditure, which has impeded implementation of DiHPART guided decision making. However, during its implementation, DiHPART has become an influential resource mobilization tool, providing district managers with evidence to lobby political officials for additional resources.

Mozambique

The Mozambique PHIT strategy focuses on strengthening the MOH’s established HIS through applying innovative approaches to improve HIS quality and foment its use for resource allocation, program monitoring, and service delivery improvements at the facility, district, and provincial levels (Figure 2). The Mozambique project has introduced simplified tools based on routine HIS data to highlight service delivery performance success and problems at the facility and district levels. The project team mentors district and facility health managers to use these tools for identifying, implementing and evaluating efforts to improve health system performance.

Rationale and contextual appropriateness

The PHIT strategy is designed to work within the MOH priorities, specifically to strengthen the quality and use of the existing information system (Módulo Básico). The partnership has adopted and modified nationally developedtraining modules and data assessment approaches in developing an intervention that is contextually appropriate for district managers.

The PHIT strategy endeavors to improve HIS quality from the facility, district, and provincial levels in Sofala province. Strengthening data for decision making focuses on the district level – the key management unit to support and monitor service delivery improvements at the facility level. Under the government of Mozambique’s decentralization program, district managers are increasingly responsible  for   resource allocation (including financial and non-financial resources, such as human resources), as well as monitoring and evaluating program activities. The PHIT strategy therefore builds district capacity for using data for decision making and supports their linkages with health facilities to lead to health system improvements.

Activities and feedback mechanism

Data quality includes training and supporting district and provincial statistics personnel to continuously monitor the performance of the HIS and the provision of timely feedback to facility and district managers to lead to incremental improvements in HIS quality. Furthermore, an annual data quality assessment (DQA) for primary health care (PHC) services is carried out in all districts in the PHIT intervention province, with feedback provided to district and health facility managers via a summary data quality ranking tool that acknowledges facilities with high data quality and identifies facilities with poor data quality for follow-up by health system managers and PHITsupported personnel [32]. After health facilities with glaring or persistent data quality problems are identified (those in the lowest category of the ranking process), district and provincial health managers provide supportive supervision to facility managers and staff that includes a re-introduction to the HIS and associated tools, clarification of timing and procedures for reporting, and reinforcement of the importance of the HIS. Technical and financial support is also provided to develop and maintain infrastructural capacity to computerize facility summary reports at the district level and send them electronically for monthly collation at the provincial level. Identifying problems and making informed decisions based on up-to-date data from the HIS is promoted at the facility, district, and provincial levels. District and facility managers are trained and mentored to build competencies and routine practices for basic data analysis, including indicator development and secular trend analysis. Simple tools and graphical representations using routinely collected data have been developed, field tested, and implemented for health system managers to use for monitoring primary health care indicators, target interventions, target resources at the district (to improve facility performance), and provincial levels (to improve district performance) [32] and evaluate whether interventions have led to intended service delivery improvements.

Adaptation and learning during implementation

During the six-month planning grant, the Mozambique PHIT Partnership piloted and refined a province-specific DQA methodology, which are now in use [14]. Annual assessment results are disseminated to health facility, district, and provincial managers using a simplified ranking system that was developed based on suggestions from a provincial data quality feedback session. Tools to summarize and regularly compare key PHC indicators across facilities and districts have evolved in design and content over the first three years of implementation to include fewer indicators and focus on secular trend analysis and graphic comparisons among peer facilities and districts. Efforts to promote use of data for decision making have also evolved to go beyond training health managers in data systems, indicator development, and analysis approaches. Periodic district-level review and planning meetings bring together peer facility staff with district and provincial leadership to promote active data review combined with planning and monitoring of plan implementation with key stakeholders.

Rwanda

In Rwanda, the Ministry of Health (MOH) and Partners In Health (PIH) have co-developed an electronic medical record (EMR) system (OpenMRS)[23] and are implementing an enhanced version as part of the PHIT Partnership (Figure 3). In the three PIH-supported districts of Rwanda the EMR holds patient records for 33 health centers, including a catchment area of approximately 800,000 people. The EMR system includes comprehensive medical records for all patients with HIV, tuberculosis, heart failure, epilepsy, hypertension, asthma, chronic obstructive pulmonary disease, diabetes, and cancer. In addition, a medical record system has been developed and is being implemented for acute outpatient consults, including registration, presentation, diagnosis, laboratory tests, and treatment. The EMR supports patient care by providing clinicians with summaries of patient visits and laboratory test results; through reports of at-risk patients (including those with missed visits, low CD4 counts, unsuppressed viral load, and high HBA1c) [24] and through administrative reports to support clinic management, resource allocation, and quality improvement (QI).

Rationale and contextual appropriateness

Though hospitals have paper patient charts recording prior admissions and emergency room visits, the primary care facilities in the project area do not have a standardized comprehensive outpatient paper-based record. As a result, acute and chronic medical history is not always immediately available to clinicians during patient consultation, and information does not always flow optimally between the levels of care. The EMR system allows for synthesis and access to patient history from chronic and acute outpatient encounters at both levels of care. In addition to the nationally required HIS reports, key EMR outputs include customized reports for QI, administration, and infectious disease monitoring. At present, patient registration data have been used to identify geographic areas with low access to acute outpatient services, while chronic care reports guide care for patients with chronic conditions (including HIV, TB, diabetes, hypertension, heart disease, asthma/ COPD and cancer). The MOH has commenced implementation of a nationwide comprehensive electronic medical record system, based partly on the partnership’s work. Core work for this included agreement on standard terminology for national use, including symptoms and diagnoses linked to international standards and development of a tested and refined user interface. This collaboration ensures that parallel systems are not created, with one national information system that integrates across EMR components and feeds into national HIS reporting requirements.

Activities and feedback mechanism

Tools that are being introduced include an electronic patient registration system and an acute patient visit record. Each of these have reports as part of the feedback loop that aggregate data at the facility and district levels (for reporting and administrative purposes), as well as the individual patient level for QI and patient tracking purposes. Training is conducted for data officers and coordinators on a quarterly basis, just prior to the quarterly software releases that deliver new content. Clinicians receive both formal and on-the-job training on using the systems and have a point person from the EMR team to support them.

Adaptation and learning during implementation

In order to allow for integration with the national implementation, the health information model was revised after the terminology standards were discussed with the national e-Health Technical Working Group. Additionally, a training schedule based around software releases and accompanied by more formalized training materials has been developed based on identified field needs.

Tanzania

The Connect Project aims to improve community-level availability, accessibility, and quality of primary health care services using community health agents (CHA) in three districts in rural Tanzania [34]. The Connect Project has adapted and adopted existing community-level health information data capture tools and is working with CHAs

to collect and integrate community-level data with the routine HIS at facility and district levels (Figure 4), with

data feedback targeting workers at the community, dispensary, health center, and hospital levels.

Rationale and contextual appropriateness

Although the MOH has developed community-level data collection tools, integrating collected data into the MOH HIS (MTUHA) has been challenging. Facility-based health workers are intended to use the community-level module (MTUHA III) to collect information on a range of community health indicators and report to their corresponding council health management teams (CHMT), who use this information to design an accurate profile of their district and develop Comprehensive Council Health Management Plans. Currently, MTUHA III is not fully or uniformly operative throughout the country owing to a range of systems factors, including workforce shortages that prevent timely and frequent community outreach. The CHA represents an opportunity to pilot and refine approaches to integrate community health information to the MTUHA system.

The Connect project supports integration of community data in the national MTUHA in order to improve the comprehensiveness and quality of health information in general and prompt data interpretation, discussion,

and problem solving in community settings. Integration efforts have focused on working with CHA clinical supervisors, village leaders, and CHMT MTUHA coordinators

to facilitate their administrative ownership over reporting and utilization of service delivery information from CHAs. As health system and community stakeholder support is built, the Connect HIS system will be customized to reflect the data and reporting requirements of the MTUHA HIS.

Activities and feedback mechanism

Connect staff worked with MTUHA supervisors to develop two community registers (one for service delivery outputs, a second for community mobilization and Symptoms and findings Diagnoses (confirmed, suspected, primary secondary) Laboratory /radiology tests ordered and results Treatment (medications, procedures, referral) Prior acute care history Prior chronic care history (HIV, TB, Diabetes, Heart Failure, Hypertension, Asthma/COPD, cancer) National HIS monthly report (acute outpatient section) Clinical reports for patient follow-up Aggregate reports for Quality Improvement and administration (as defined by District Hospital) Data available for use in nationally approved research studies Current and past medications Vital signs Infectious disease and outbreak monitoring Existing data available to support decision-making Acute Clinical visit data input Acute Clinical data output Figure 3 Visual framework for the health information intervention – Rwanda Mutale et al. BMC Health Services Research 2013, 13(Suppl 2):S9 http://www.biomedcentral.com/1472-6963/13/S2/S9 Page 7 of 12 health education activities) that provide simple project indicators aligned with the MTUHA III modules. Additional health information summary forms were developed for CHAs to record aggregate data from their registers and report each month to supervisors from their community, the health system, and the Connect team. CHAs and supervisors from both health facilities and village governments meet regularly to review monthly outputs, identify and troubleshoot problems, and plan jointly with the health system. Connect project coordinators, district MTUHA coordinators, and CHA supervisors hold similar meetings quarterly and transfer CHA health information to district and project managers for planning and program improvement.

Adaptation and learning during implementation

Data feedback to the CHAs was initially delayed due to the evolving nature of the intervention, the large number and geographic dispersion of study clusters, and variation in CHA supervisor leadership qualities and motivation. To overcome these barriers, the Connect team works with CHA supervisors to motivate their involvement and cover transportation costs incurred while making supportive supervision visits to CHA. There are notable challenges in collecting and using community-based health information. Supervision visits to all CHAs following initial deployment revealed minor problems concerning the uniformity and proper use of the registers. Project staff and supervisors compiled findings from these visits and convened CHAs in the respective study areas in a joint review of the registers to clarify register use. Management of community-based health information has also been a challenge. Though registers are appropriate for recording service delivery information and aggregating data, they did not facilitate CHAs data use for improving client-focused care as they did not capture household and client information, nor qualitative aspects of service encounters that would be useful for follow-up service encounters. Therefore, the project introduced booklets that remain in each village household where CHAs can log more detailed notes Figure 4 Visual framework for the health information intervention – Tanzania Mutale et al. BMC Health Services Research 2013, 13(Suppl 2):S9 http://www.biomedcentral.com/1472-6963/13/S2/S9 Page 8 of 12 from each visit, which has come at a high financial and logistical cost. Patient referrals from CHAs has also been a challenge, as post-referral feedback from health facilities to guide CHA follow-up services has been erratic. To facilitate the CHA/health facility communication, CHAs, supervisors, and referral providers have been provided closed-user phone groups to communicate without incurring costs.

Zambia

The Better Health through Mentorship and Assessment (BHOMA) project is using an Electronic Data Capture System (EDCS) and mobile technology to improve the quality of data captured in the target districts. The BHOMA system includes a dedicated low-wattage Linux client terminal (powered by solar panels and a 12-volt battery pack) with touch screen data entry terminals attached to a miniature data processing server, into which patient visit information is entered (Figure 5). The system automatically generates performance reports based on predetermined performance indicators that identify facility-level performance gaps and are used by clinical QI teams to mentor facility staff on improving clinical care quality. The EDCS system also automatically generates and sends follow-up messages via general packet radio service (GPRS) technology to CHWs (via mobile phones) to indicate a need for patient follow-up. Using modems and cellular networks, BHOMA clinics access the internet to securely synchronize records to a central server, housed at CIDRZ headquarters in Lusaka, which, in turn, transmits the data to BHOMA district offices, and the MOH’s District Health Offices.

Rationale and contextual appropriateness

Poor quality data has been a source of concern throughout Zambia and data are frequently not used for evidence-based planning. Furthermore, community-level data are often not collected or used. The expansion of HIV care and treatment in Zambia brought EMR systems to some rural health facilities, which demonstrated their feasibility for capturing patient-level data in real time and their utility in guiding decision making by health system managers. Increases in mobile technology coverage in Zambia has made internet widely available, providing an opportunity to leverage ICT for collection of patient and community level data in real time and to use these data for evidence-based decision making

Activities and feedback mechanism

There are six data entry screens (patient registration, adult, pediatric, sick antenatal care (ANC), normal ANC, and labor and delivery) that follow the flow of information on clinical forms. Data are entered and locally and available in real time. To date, BHOMA has trained 72 clinic supporters to enter data for each patient visit and run reports. The five reports include 1) Clinic report (summarizing the number of patient visits at each facility, including followup visits for patients with danger signs or severe symptoms who missed their appointment); 2) Patient review report (listing patient charts for the QI teams to review Figure 5 Visual framework for the health information intervention – Zambia Mutale et al. BMC Health Services Research 2013, 13(Suppl 2):S9 http://www.biomedcentral.com/1472-6963/13/S2/S9 Page 9 of 12 with clinic staff); 3) Clinic performance reports (summarizing twelve clinical care measures for QI teams and clinic staff to use as a snapshot of clinical care quality); 4) CHW performance report (summarizing follow-up and assessment activity levels for CHWs at the health facility); and 5) HIS reports (to remove duplicate burden of tallying data). Each clinic has a GPRS modem that uses Zambia’s cell phone networks to synchronize de-identified patient records to a central district database every 15 minutes when the system is on. Each district office has a server that aggregates information from all clinics in that district, allowing the QI teams to print patient review and clinic performance reports in preparation for each supportive mentoring visit.

Adaption and learning during implementation

The BHOMA HIS model has been deployed in largely rural, remote, and understaffed facilities and lessons have become clear during implementation. First, reviewing and clarifying data entry fields reduced the data entry workload. Second, computers with low-power requirements that run on solar power with battery back-up systems are important due to the unreliability of power. Third, using a dedicated client that runs only the BHOMA software avoids viruses, facilitates updates, and simplifies replacement. Fourth, it is essential that clinic performance reports are immediately available at the clinic level — rather than cycling first through the district — for health facility managers to identify areas requiring improvements and to check whether the corrective measures are working. Finally, patient-level information (rather than aggregate data) is used for flagging specific patient charts for followup with targeted intervention.

Comparisons across the PHIT strategies

Although the five PHIT Partnerships have designed different approaches to strengthen health systems in their respective countries, they share common features in enhancing HIS and linking data with improved decision making. Recognizing the complexity and context-specific nature of the intervention settings, PHIT Partnerships have adopted a flexible, iterative approach in designing and refining the development of new tools for HIS enhancement and improved decision making. Across the partnerships, the tools and approaches are designed to actively provide health system performance summaries to enable health system personnel to make informed decision on where to focus their efforts and limited resources. A second common feature is the use of feedback systems to improve data quality, though the error detection and correction approach varies across PHIT Partnerships. Error-detection approaches include automated troubleshooting mechanisms, routine review of aggregate reports for outliers and missing data, or periodic DQAs. A final similarity across PHIT Partnership approaches is the recognition of the importance of MOH information systems to ensure that HIS strengthening efforts are aligned with national priorities and to increase the likelihood of sustained project approaches beyond the life of the African Health Initiative. However, approaches across Partnerships vary in terms of pace and degree of alignment, which can be best described as either front-end integration (Mozambique), progressive integration (Rwanda), current harmonization (Ghana), and potential future harmonization or integration (Tanzania and Zambia). Despite these similarities, there are notable differences in the PHIT Partnership approaches to HIS strengthening and improved decision making. One difference is the level of focus for data collection, and by extension, its use. The Rwanda, Tanzania and Zambia PHIT Partnerships begin with intensive collection of patient-level data, while the Ghana and Mozambique Partnerships focus on facility, district and provincial-level aggregate data. In addition, the Ghana, Tanzania and Zambia data systems incorporate data from community service provision to direct outreach services from either formal or community health cadres. All systems, however, have sufficient flexibility to manipulate data according to frequency of aggregation (daily, monthly, quarterly, annual), and level of aggregation (health facility, district or province). A second difference is the type of data collection system, with the Rwanda and Zambia Partnerships implementing new EMR systems, while the Ghana, Mozambique, and Tanzania partnerships focus on paper-based HIS that are computerized at the health facility or district levels.

Discussion

Through the African Health Initiative, the five PHIT Partnerships have designed and are testing novel approaches to enhancing data systems and using HIS results as a driver for decision making and health system performance improvements. Design differences described across the PHIT Partnerships reflect the different theories of change for each project, particularly with regards to what information is needed, who will use the information to affect change, and how this change is expected to manifest. Ghana and Tanzania have simplified paper registries that incorporate data on community service provision, and in Ghana a resource allocation tool pioneered in Tanzania intends to support district managers in decision making. Mozambique focuses on strengthening the existing national HIS, and provides data summaries for health system managers to identify problems, evaluate solutions, and allocate resources. Zambia and Rwanda are implementing ICT approaches to improve Mutale et al. BMC Health Services Research 2013, 13(Suppl 2):S9 http://www.biomedcentral.com/1472-6963/13/S2/S9 Page 10 of 12 data quality, and provide timely information to guide decision making for clinicians and managers. Though implementation of the PHIT interventions is ongoing, there has been significant country-level enthusiasm for building on the HIS innovations of the African Health Initiative, with elements of the programs being adopted nationally in PHIT Partnership countries. The first three years of PHIT implementation has highlighted a number of elements important for strengthening HIS and linked decision making. First, though an important starting point, training alone is insufficient to engage and build capacity for facility and community health workers. Stakeholder meetings, data reviews, and mentored use of data as a basis for decisions have been utilized to engage health workers and managers and demonstrate the value of data, HIS quality, and ownership of tools to summarize data and guide decision making. A second lesson learned is that it is critical for HIS interventions to be developed in the context of the national HIS, which has been feasible across PHIT Partnerships and is crucial to ensuring sustainability of the programs beyond the project lifespan. Finally, in two of the PHIT Partnerships, the increased availability of mobile phone technology has facilitated the introduction of EMR systems in rural, resource constrained environments. These ICT innovations have come at a high initial financial cost to build infrastructure, modify software, and build human resource capacity for their use. Like many complex health system interventions, success of the PHIT HIS and decision-making approaches will hinge on whether frontline health workers and managers value, adopt and own the tools and procedures introduced by the country Partnerships [19,21]. For HIS to have an impact on health system functioning, and ultimately population health, it will be the institutionalization of habits and norms around data that will make the difference, such that prioritizing and using quality data is as much a part of routine practice as stocking a pharmacy or immunizing a child. Though exploring different approaches, all PHIT Partnerships are working towards the goal of standardized and routinely used procedures to improve data quality, its availability, and use. The PHIT Partnerships have both a common evaluation framework and project specific evaluation plan in place to assess their impact on health system functioning and population health [36]. Identifying effective and appropriate strategies for improving data availability, quality and its use, as well as the role of HIS in improving the health service delivery (including the quality and coverage of these services), will contribute to the limited evidence on this health system building block. Taking lessons learned to scale, however, will require substantial investment in general PHC information systems rather than disease specific information systems that can fragment, distort, and weaken country HIS at all levels of the health system [25].Without a well-functioning HIS, it is unlikely that the remaining five building blocks of a health system can reach their full potential in improving population health [26-28].

List of abbreviations used

BHOMA: Better Health through Mentorship and Assessment; CHA: Community health agent; CHMT: Community Health Management Team; CHO: Community health officer; CHW: Community health worker; CIDRZ: Center for Infectious Disease Research in Zambia; DHIMS-2: District Health Information Management System; DiHPART: District Health Planning and Reporting Toolkit; DQA: Data quality assurance; EDCS: Electronic data capture system; EMR: Electronic medical record; GEHIP: Ghana Essential Health Intervention Project; GPRS: General packet radio service; HIS: Health information system; HIV: Human immunodeficiency virus; ICT: Information communication technologies; LMIC: Low and middle income country; MOH: Ministry of Health; MTUHA: MOH health information system in Tanzania; MTUHA III: MOH HIS community-level module in Tanzania; PHC: Primary health care; PHIT: Population Health and Implementation Training; PIH: Partners In Health; QI: Quality Improvement; TB: Tuberculosis.

Competing interests

The authors declare that they have no competing interests.

Acknowledgements

This work was supported by the African Health Initiative of the Doris Duke Charitable Foundation. K Sherr was supported by Grant Number K02TW009207 from the Fogarty International Center; the content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. We would also like to thank the members of the Population Health Implementation and Training – African Health Initiative Data Collaborative for their contributions to this manuscript. Members include: Cheryl Amoroso, Manzi Anatole, John Koku Awoonor-Williams, Helen Ayles, Paulin Basinga, Ayaga A. Bawah, Colin Baynes, Harmony F. Chi, Roma Chilengi, Namwinga Chintu, Angela Chisembele-Taylor, Jeanine Condo, Fatima Cuembelo, Felix Rwabukwisi Cyamatare, Peter Drobac, Karen Finnegan, Sarah Gimbel, Stephen Gloyd, Jessie Hamon, Ahmed Hingora, Lisa Hirschhorn, Marina Kariaganis, Handson Manda, João Luis Manuel, Wendy Mazimba, Mark Micek, Cathy Michel, Megan Murray, Fidele Ngabo, Anthony Ofosu, James Pfeiffer, James F. Phillips, Alusio Pio, Ab Schaap, Kenneth Sherr, Ntazana Sindano, Allison Stone, Jeffrey S. A. Stringer. Declarations This article has been published as part of BMC Health Services Research Volume 13 Supplement 2, 2013: Improving primary health care to achieve population impact: the African Health Initiative. The full contents of the supplement are available online at http://www.biomedcentral.com/ bmchealthservres/supplements/13/S2. Publication of this supplement was supported by the African Health Initiative of the Doris Duke Charitable Foundation.

List of References

1. World Health Organization: Strengthening Health Systems to Improve Health Outcomes: WHO’s Framework for Action. Geneva: World Heatlh

Organization; 2007.

2. World Health Organization: Health Metrics Network Framework and Standards for Country Health Information Systems. Geneva: World Heatlh

Organization; 2008.

3. Bodart C, Sapirie S: Defining essential information needs and indicators. World Health Forum 1998, 19(3):303-309.

4. Simba DO, Mwangu M: Application of ICT in strengthening health information systems in developing countries in the wake of globalisation. Afr Health Sci 2004, 4(3):194-198.

5. Peersman G, Rugg D, Erkkola T, Kiwango E, Yang J: Are the investments in national HIV monitoring and evaluation systems paying off? J Acquir Immune Defic Syndr 2009, 52(Suppl 2):S87-96.

6. Jha P, Mills A, Hanson K, Kumaranayake L, Conteh L, Kurowski C, Nguyen SN, Cruz VO, Ranson K, Vaz LM, et al: Improving the health of the

global poor. Science 2002, 295(5562):2036-2039.

7. Larsson EC, Atkins S, Chopra M, Ekstrom AM: What about health system strengthening and the internal brain drain? Trans R Soc Trop Med Hyg 2009, 103(5):533-534, author reply 534-535.

8. Mate KS, Bennett B, Mphatswe W, Barker P, Rollins N: Challenges for routine health system data management in a large public programme

to prevent mother-to-child HIV transmission in South Africa. PLoS One 2009, 4(5):e5483.

9. Garrib A, Stoops N, McKenzie A, Dlamini L, Govender T, Rohde J, Herbst K: An evaluation of the District Health Information System in rural South Africa. S Afr Med J 2008, 98(7):549-552.

10. Ronveaux O, Rickert D, Hadler S, Groom H, Lloyd J, Bchir A, Birmingham M:

The immunization data quality audit: verifying the quality and consistency of immunization monitoring systems. Bull World Health Organ

2005, 83(7):503-510.

11. Lim SS, Stein DB, Charrow A, Murray CJ: Tracking progress towards universal childhood immunisation and the impact of global initiatives: a

systematic analysis of three-dose diphtheria, tetanus, and pertussi immunisation coverage. Lancet 2008, 372(9655):2031-2046.

12. Gething PW, Noor AM, Gikandi PW, Ogara EAA, Hay SI, Nixon MS, Snow RW, Atkinson PM: Improving imperfect data from health management

information systems in Africa using space–time geostatistics. PLoS Med2006, 3(6).

13. Chilundo B, Sundby J, Aanestad M: Analysing the quality of routine malaria data in Mozambique. Malar J 2004, 3:3.

14. Gimbel S, Micek M, Lambdin B, Lara J, Karagianis M, Cuembelo F, Gloyd SS,Pfeiffer J, Sherr K: An assessment of routine primary care health information system data quality in Sofala Province, Mozambique. Popul

Health Metr 2011, 9:12.

15. Mphatswe W, Mate KS, Bennett B, Ngidi H, Reddy J, Barker PM, Rollins N: Improving public health information: a data quality intervention in KwaZulu-Natal, South Africa. Bull World Health Organ 2012, 90(3):176-182.

16. The Routine Data Quality Assessment (RDQA) Tool: Guidelines for Implementation for HIV, TB and Malaria Programs. [http://www.

theglobalfund.org/en/me/documents/dataquality/].

17. Williams F, Austin Boren SA: The role of the electronic medical record (EMR) in care delivery development in developing countries: a

systematic review. Informatics in Primary Care 2008, 16:139-45.

18. Wager KA, Lee FW, White AW, Ward DM, Ornstein SM: Impact of an electronic medical record system on community-based primary care

practices. J Am Board Fam Med 2000, 13(5).

19. Redsell SA, Buck J: Health-related decision making: the use of information giving models in different care settings. Qual Prim Care 2009,

17(6):377-379.

20. Corrao S, Arcoraci V, Arnone S, Calvo L, Scaglione R, Di Bernardo C, Lagalla R,Caputi AP, Licata G: Evidence-based knowledge management:

an approach to effectively promote good health-care decision-making

in the information era. Intern Emerg Med 2009, 4(2):99-106.

21. Camporesi S: Better, and ‘healthier’ decision making through information technology: conference report from the Health 2.0 conference in San Francisco, September 2011. Ecancermedicalscience 2011, 5:242.

22. Frimpong J, Awoonor-Williams J, Stone A, Helleringer S, Yeji F, Schmitt M,

Phillips J: Strengthening routine health information systems in rural communities: an approach to improving service delivery and an

antecedent for electronic health infromation systems. Second Global Symposium on Health Systems Research: Beijing China 2012.

23. Mamlin BW, Biondich PG, Wolfe BA, Fraser H, Jazayeri D, Allen C, Miranda J, Tierney WM: Cooking up an open source EMR for developing countries: OpenMRS – a recipe for successful collaboration. AMIA Annu Symp Proc

2006, 529-533.

24. Amoroso CL, Akimana B, Wise B, Fraser HS: Using electronic medical records for HIV care in rural Rwanda. Stud Health Technol Inform 2010,

160(Pt 1):337-341.

25. Chan M, Kazatchkine M, Lob-Levyt J, Obaid T, Schweizer J, Sidibe M, Veneman A, Yamada T: Meeting the demand for results and

accountability: a call for action on health data from eight global health

agencies. PLoS Med 2010, 7(1):e1000223.

26. Adam T, Hsu J, de Savigny D, Lavis JN, Rottingen JA, Bennett S: Evaluatinghealth systems strengthening interventions in low-income and middleincome countries: Are we asking the right questions? Health Policy and

Planning 2012, 27(Suppl 4):iv9-iv19. health systems strengthening interventions in low-income and middleincome countries: Are we asking the right questions? Health Policy and

Planning 2012, 27(Suppl 4):iv9-iv19.

27. Adam Taghreed, de Savigny Don: Systems thinking for strengthening health systems in LMICS: need for a paradigm shift. Health Policy Plan

2012, 27(Suppl 4):iv1-iv3.

28. WHO: Systems Thinking for Health Systems Strengthening. 2009.

29. Bassett MT, Gallin EK, Adedokun L, Toner C: From the ground up:strengthening health systems at district level. BMC Health Services

Research 2013, 13(Suppl 2):S2.

30. Awoonor-Williams JK, Bawah A, Nyonator F, Asuru R, Oduro A, Ofosu A,Phillips J: The Ghana Essential Health Interventions Program: a plausibilitytrial of the impact of health systems strengthening on maternal & child

survival. BMC Health Services Research 2013, 13(Suppl 2):S3.

31. Sherr K, Cuembelo F, Michel C, Gimbel S, Micek M, Kariaganis M, Pio A, Manuel JL, Pfeiffer J, Gloyd S: Strengthening integrated primary health

care in Sofala, Mozambique. BMC Health Services Research 2013, 13(Suppl 2):S4.

32. Drobac PC, Basinga P, Condo J, Farmer PE, Finnegan K, Hamon JK, Amoroso C, Hirschhorn LR, Kakoma JB, Lu C, Murangwa Y, Murray M,

Ngabo F, Rich M, Thomson D, Binagwaho A: Comprehensive and integrated district health systems strengthening: the Rwanda Population

Health Implementation and Training (PHIT) Partnership. BMC Health Services Research 2013, 13(Suppl 2):S5.

33. Ramsey K, Hingora A, Kante M, Jackson M, Exavery A, Pemba S, Manzi F, Baynes C, Helleringer S, Phillips JF: The Tanzania Connect Project: a cluster-randomized trial of the child survival impact of adding paid community health workers to an existing facility-focused health system.

BMC Health Services Research 2013, 13(Suppl 2):S6.

34. Stringer JSA, Chisembele-Taylor A, Chibwesha CJ, Chi HF, Ayles H, Manda H, Mazimba W, Schuttner L, Sindano N, Williams FB, Chintu N, Chilengi R: Protocol-driven primary care and community linkages to improve population health in rural Zambia: the Better Health Outcomes through

Mentoring and Assessment (BHOMA) project. BMC Health Services Research 2013, 13(Suppl 2):S7.

35. Bryce J, Requejo JH, Moulton LH, Ram M, Black RE, Population Health Implementation and Training – Africa Health Initiative Data Collaborative: A common evaluation framework for the African Health Initiative. BMC Health Services Research 2013, 13(Suppl 2):S10.

Facebooktwittergoogle_pluslinkedinmail

Mortality and Cause of Death Profile for Deaths from the Civil Registration System: 2017 Facts and Figures

Authors: Martin Nyahoda1*, Jeremiah Banda2, Chomba Mwango2, Brian Munkombwe3, Francis Notzon3.

1. Department of National Registration Passport Citizenship, Lusaka, Zambia.
2. Bloomberg Data for Health Initiative, Lusaka, Zambia
3. International Statistics Division, Centre for Disease Control and Prevention, Hyattsville USA.

Download PDF


Citation style for this article: Nyahoda M , Banda J, Mwango C, Mukombwe B, Notzon F. Mortality and Cause of Death Profile for Deaths from the Civil Registration System: 2017 Facts and Figures. Health Press Zambia Bull. 2018;2(9); pp 17-25.


The Department of National Registration Passport and Citizenship is mandated to register vital events including deaths and causes of deaths. However, death registration is still low at less than 20 percent nationwide.  About 65 percent of the deaths occur in health facilities while 35 percent take place outside health facilities. HIV was the leading cause of death, accounting for about 24 percent of all health facility deaths in 2017.  Gestation and fetal growth disorders were the most common among children in the age group 0-4 years. With respect to
non-communicable diseases, 29 percent of the deaths were caused by cardiovascular diseases. Road traffic accidents accounted for about 29 percent of the external causes of death.

Background
The Department of National Registration Passport and Citizenship (DNRPC) is the Civil Registration authority in Zambia, whose mandate is to register all vital events occurring in Zambia as established in the Births and Deaths Registration Act (Cap 51) of the laws of Zambia[1]. Despite the legal basis of the system and 40 years of implementation, less than 20 percent of all deaths are registered[2]. The Sample Vital Registration with Verbal Autopsy (SAVVY) reports that approximately 53 percent of deaths occur in health facilities and 47 percent outside of health facilities[3]. Statistics on mortality and causes of death assist in the formulation of evidence-based health policies and decision-making as well as implementation of cost-effective health interventions[4].

Importance of Information on Cause of Death
Efforts are being made to increase death registration coverage in Zambia. Various interventions are being implemented with the support of cooperating partners, including the Bloomberg Data for Health Initiative (BD4HI). Training of medical doctors and ICD-10Coders are among the interventions aimed at improving the quality of Cause of Death (COD) certification and coding, respectively. Currently, a pilot study on verbal autopsy which involves the collection of probable causes of death is taking place outside some selected health facilities in Lusaka. Such deaths are unlikely to be certified; hence, no health information is recorded. Other interventions on improving coverage include the improvement in health facility reporting of all deaths, use of village administrative systems to facilitate the registration of community deaths, reviewing of laws pertaining to death registration and the use of Enterprise Architecture (EA) to strengthen the processes in death registration. This paper presents findings on deaths occurring in health facilities. The deaths were routinely registered in 2017 and had Medical Certificates of Cause of Death (MCCDs).

Distribution of Deaths
Out of 29,164 routinely registered deaths in 2017  the majority, of deaths,  occurred in health facilities accounting for 64.7 percent, 32.2 percent occurred outside health facilities and 0.3 percent occurred in others places such as hospices/retirement homes.

Figure 1: Distribution of deaths registered in 2017

n = 29,164

Figure 1 above shows percentage distribution of the 29,164 deaths registered in 2017 at DNRPC. The majority of deaths (59.8 percent) were from Lusaka, followed by Copperbelt (26.1 percent) and Central (9 percent). The remaining provinces had a combined total of 5.1 percent.  

Figure 2: Place of Death

n=29,164

Figure 2 displays a total of 29,164 deaths registered in 2017 by place of death. About 18,869 deaths representing 67.5 percent of deaths occurred in health facilities, 10,237 deaths (35.1 percent) at home and 58 deaths (0.2 percent) in other places, including hospices and retirement homes.

1. Causes of Death in Health Facilities

The extent and pattern of distribution of causes of death can inform policy and stimulate programme planning and implementation.

Figure 3: Causes of Death Distribution among Males and Females Combined (All Ages)

n = 18,875

Figure 3 gives the leading causes of death for both sexes and all ages.  Among the ten leading causes of death, HIV disease was the most prominent, representing 23.7 percent, followed by tuberculosis, representing 5 percent. Other bacterial and hypertensive diseases accounted for about 3.5 percent each.

Figure 4:  Leading Cause of Death Distribution by Sex (all ages)
Female = 8,398                        Male = 10,477

Figure 4 shows that HIV disease was the leading cause of death in 2017 for both females and males, thus, 24.4 and 23.1 percent, respectively.  For females,  the next leading causes of death were hypertensive diseases, causing 4 percent of the deaths,  gestation and fetal growth disorders, accounting for 3.9 percent, and tuberculosis and other bacterial diseases, each accounting for 3.3 percent. The distributions of causes of death are similar for males and females, with minor variations. However, percentages of all other causes of death were about 5 percent higher among women compared with men.

Figure 4: Leading Causes of Death among Children Aged 0-4 Years


n = 3,577

Among the leading causes of death for children aged 0-4 years, out of 3,577 deaths, 17 percent were related to gestation and fetal growth disorders, followed by malnutrition, which accounted for 10.8 percent, infections specific to the perinatal period, accounting for about 6.6 percent, respiratory and cardiovascular disorders,  accounting  for 6.3 percent, and other bacterial diseases, accounting for 4.1 percent. Other disorders originating in the perinatal period and Influenza including Pneumonia accounted for 3.8 percent each. HIV disease accounted for 3.5 percent of deaths. Deaths due to fires were 2.4 percent and intestinal infectious diseases amounted to 2.0 percent.  Undetermined causes of deaths were 19.8 percent of the total number of deaths in this age group.

Figure 5: Leading Causes of Death Among Children Aged 5-14 Years

n = 577

Figure 5 shows that deaths caused by HIV disease among those aged 5-14 years had the highest occurrence at about 15.6 percent, followed by Haemolytic anemia, accounting for 5 percent of deaths. Central nervous system diseases contributed 3.5 percent of deaths. Tuberculosis, malaria and neoplasms of secondary and unspecified sites each accounted for 3.1 percent.  All other causes combined accounted for 31.7 percent.

Fig 6: Leading Causes of Death among Adults Aged 15+ Years

n = 14,439

In Figure 6 above, out of 14, 439 deaths, HIV disease was the highest leading cause of death in the 15 and older age group, as it was in those aged 5 to 14. However, the percentage of HIV deaths in those aged 15 and older is much higher at about 29.2 percent compared to 15.6 percent in those aged 5 to 14. Tuberculosis caused about 6.3 percent of deaths, followed by hypertensive diseases, which caused 4.5 percent. Other bacterial diseases were responsible for 3.4 percent of deaths.  Cerebrovascular diseases and diabetes mellitus caused 2.9 and 2.8 percent of deaths, respectively. All other causes combined accounted for 29.4 percent, while ill-defined and undetermined causes accounted for about 13.6 percent.

Communicable Diseases

Figure 7:  Leading Causes of Death Due to Communicable, Maternal, Perinatal and Nutritional Conditions

n= 11,543

Figure 7 gives the leading causes of death due to communicable diseases for both sexes and all ages.  Among the ten leading causes of death was HIV, representing 47.3 percent of deaths, followed by infections during the perinatal period, accounting for about 14.4 percent. Tuberculosis represented 10 percent of deaths, followed by other infectious diseases and nutritional deficiencies, at 8.8 percent and 7.2 percent, respectively.

Non-Communicable Diseases

Figure 8: Percentage Distribution of Deaths Due to Non-Communicable Causes

n = 6,633

About 5,437 deaths were caused by non-communicable diseases. About 29.2 percent were due to cardiovascular diseases, followed by 25.2 percent due to malignant neoplasms.  Digestive diseases caused 9.7 percent of deaths, followed by diabetes mellitus, with 7.6 percent of the deaths, genito-urinary diseases, with 7.1 percent, and endocrine disorders, with 6.5 percent. All other causes combined only caused 2.7 percent of the deaths. There were no ill-defined or undetermined causes of death in this category.

Fig 9: Percentage Distribution of Leading Deaths Due to External Causes

n = 699

In Figure 9, there were about 699 deaths due to external causes.  The highest percentage of deaths, about 28.9 percent, were caused by other land transport accidents, followed by 21 percent of deaths caused by exposure to other and unspecified factors, 12.7 percent caused by intentional self-harm, 10.2 percent due to exposure to smoke, fire and flames, and 5.8 percent due to drowning and submersion.

Figure 10: Percentage Distribution of Deaths Due to HIV Disease by Sex and Age Groups

Figure 10 displays the distribution of deaths due to HIV disease. There was a decline in deaths due to HIV from ages 0-4 to ages 5-9. Thereafter, there was an increase in deaths for both males and females, peaking at age group 35-39. There were generally more deaths among females in age groups younger than 35-39 while deaths among males exceeded those of females for age group 64-69 and older.

Figure 11: Percentage Distribution of Deaths Due to Neoplasms

Figure 11 shows the distribution of deaths due to neoplasms. There were generally more deaths among females between age groups 30-34 and 65-69. Deaths among males were higher in age groups 65-69 to 85 and over.

Conclusion

A large proportion of deaths, 32 percent routinely registered in 2017, occurred outside health facilities. The leading cause of deaths occurring in health facilities among both males and females was HIV disease, accounting for about 23.7 percent. About 5 percent of deaths in all age groups were due to tuberculosis, which was the second highest cause of death for all ages. Gestation and fetal growth disorders caused about 17 percent of deaths among children under five, followed by Malnutrition, which was the second highest cause of death at about 10.8 percent of all child deaths. Road traffic accidents contributed about 28.9 percent of deaths and were the leading cause of all external deaths. The rate of deaths from non-communicable disease was about 29 percent.

Although the information on numbers of deaths is not complete for the whole country, the information was a basis for producing useful relative distributions of the leading causes of death by age groups.  As recommended at the meeting of African Ministers responsible for civil registration, it is imperative for countries to analyze whatever data were available on vital events(5).  It is against this background that we opted to analyze the available data, which revealed some useful distributions and patterns.  There is, however, need for improvement of the reporting of deaths and their causes in all health facilities.

Acknowledgement of the contributors to Bulletin

This research paper was supported by Bloomberg Data for Health (BD4HI) and the Department of National Registration Passport and Citizenship (DNRPC) in the Ministry of Home Affairs. We thank BD4HI for providing insight and expertise that greatly assisted the research paper.

 References

1. Births and Deaths Registration Act Cap 51. Sect. Cap 51 (1973).

2. DNRPC. Civil Registration and Vital Statistics in Zambia.SAVVY Findings Dissemination Meeting; 19 April 2018; Lusaka, Zambia.

3. DNRPC. Implementation of Sample Vital Registration with Verbal Autopsy (SAVVY) in Zambia.Dissemination of SAVVY Findings; 19 April 2018; Lusaka, Zambia.

4. Mikkelsen L, Phillips DE, AbouZahr C, Setel PW, De Savigny D, Lozano R, et al. A global assessment of civil registration and vital statistics systems: monitoring data quality and progress. The Lancet. 2015;386(10001):1395-1406.

5. UNECA, editor. Fourth Conference of African Ministers Responsible for Civil Registration; 2017; Nouakchott, Mauritania.

Facebooktwittergoogle_pluslinkedinmail

InvA gene and Antibiotic Susceptibility of Salmonella spp Isolated from Commercially Processed Broiler Carcasses in Lusaka District, Zambia

TM Shamaila1,2,;  K Ndashe3,4  ; C Kasase2; M Mubanga5;  L Moonga5; J Mwansa4; BM Hang’ombe5

 1. Ministry of Fisheries and Livestock, P.O Box 38111, Monze, Zambia

2. Department of Public Health, School of Health Sciences, University of Lusaka, Lusaka, Zambia.

3. Department of Environmental Health, Faculty of Health Science, Lusaka Apex Medical University, Kasama Road, Lusaka, Zambia.

4. Department of Microbiology, Faculty of Medicine and Surgery, Lusaka Apex Medical University, Kasama Road, Lusaka, Zambia.

5. Department of Para clinical Studies, School of Veterinary Medicine, The University of Zambia, PO Box 32379, Lusaka, Zambia.

Correspondence: Kunda Ndashe (ndashe.kunda@gmail.com)

Download PDF


Citation style for this article: Shamaila TM, Ndashe K, Kasase C, et al. Inva Gene And Antibiotic Susceptibility Of Salmonella Spp Isolated From Commercially Processed Broiler Carcasses In Lusaka District, Zambia. Health Press Zambia Bull. 2018;2(6); pp 6-12.


Poultry meat is considered to be one of the major vehicles of Salmonella infections in humans and has been implicated in outbreaks of Salmonellosis in humans. The potential for mass outbreaks of Salmonellosis is likely to be linked to the high consumption of poultry meat and the increasing antibiotic resistance of Salmonella spp poses a huge challenge to treatment of the foodborne infection. Determination of virulence genes such as InvA is important as they play a vital role in the establishment and invasion of Salmonella spp in the gastrointestinal tract of the host and therefore is means of detection of the virulence of the pathogen and it is the international standard in the detection of Salmonella spp using molecular techniques.

This was a cross-sectional study where two abattoirs were sampled conveniently in Lusaka district. A total of 100 swabs were collected from the 2 abattoirs and submitted to the University of Zambia, School of Veterinary Medicine, Paraclinical Sciences laboratory were isolation and identification bacteria was conducted. Presumptive Salmonella colonies were further analysed through conducting biochemical tests, molecular detection of the virulence gene invA through polymerase chain reaction and antibiotic susceptibility testing.

The study revealed that 2% of commercially broiler carcasses were contaminated with Salmonella spp. The isolates further showed resistance to two antibiotics, gentamicin and tetracycline after antimicrobial susceptibility testing.

The presence of Salmonella spp with a virulence gene (InvA) in commercially processed broilers is a public health concern mostly in sensitive population and multi-drug resistance of the pathogen presents challenge in treatment options of Salmonellosis.

INTRODUCTION

Salmonellosis is a major public health concern and cases have been attributed to poultry and poultry products [1]. Contamination of poultry can occur through the whole production chain, from the farm to the abattoir [2]. Reports on the contamination of the broiler carcasses in abattoirs and in retail shops have been published by various workers [3-5] and among other reasons it is due to inappropriate handling and hygiene conditions [6]. Transport in inadequately cleaned and disinfected containers [7], cross-contamination by the slaughter environment or by Salmonella-contaminated flocks to the carcasses of Salmonella-free flocks are identified as possible risk factors in the abattoir [8, 9]. At slaughter, the gastrointestinal tract may harbour Salmonella and may be damaged during the evisceration, resulting in contamination of poultry carcasses [10].

For human two main pathways of exposure to salmonella in poultry meat have been identified and these are undercooking and cross-contamination [11]. During the cooking procedure, fairly high temperatures occur on the outside of meat but may not be sufficient to kill bacterial pathogens inside [12]. The contaminated undercooked poultry meat is then associated with bacterial pathogens located inside the chicken meat and serves as an exposure pathway humans [12].

The constant use of antimicrobial agents in poultry production for palliative and curative purposes as well as growth promotion is contributing factor to the emergence of antibiotic resistant bacteria that are subsequently transferred to humans through the consumption of undercooked poultry meat [13]. The use of antibiotics as growth promoter has been banned in many countries globally but antimicrobial use regulation is still a challenge in many developing countries [13]. Misuse of antimicrobials is facilitated in developing countries by their availability over the counter, without prescription and through unregulated supply chains [14].

There are over 2500 serovars of Salmonella, but only a few are commonly associated with human disease [15]. The pathogenic process of salmonellosis is usually dictated by an number of virulence genes that act in tandem and ultimately manifest in the typical symptoms of salmonellosis [16]. The virulence genes are encoded within the Salmonella pathogenicity islands (SPI) on the chromosome as units of large cassettes and these genes encode products that assist the organism in expressing its virulence in the host cells [17]. These products are produced as effector proteins and include invA, sipA, sipB, sipC, sifA, hilA, hilC, hilD and invF [18]. The distribution of these genes among the various isolates obtained from biological sources may be important in indicating the clinical significance of Salmonella [19]. The invA gene of Salmonella contains sequences unique to this genus and has been proved to be a suitable PCR target with potential diagnostic application [20]. This gene is recognized as an international standard for detection of Salmonella genus [21]. The invA gene plays a vital role in the establishment and invasion of Salmonella spp in the gastrointestinal tract of the host and therefore its detection serves as a means of determination of the virulence of the pathogen [22].

Zambia has recorded an increase in annual poultry production from 13 to 76 million broiler chickens between the 1990’s to 2016 [23]. The growth of the poultry industry has seen an increase in the source of proteins for the local population and for export to neighbouring countries [24]. The financial potential of the fast expanding poultry industry has provided opportunities for establishment of commercial abattoirs where chickens are slaughtered, processed and packaged for the retail market. Owing to processing and packaging of poultry for the market, it is important that the meat is superior in quality and free of Salmonella contamination to ensure that the consumers are protected from any possible foodborne infection [25]. It was therefore imperative that a study was conducted on Salmonella spp in commercially processed broiler carcasses to determine its prevalence, antibiotic susceptibility and presence of the virulence gene (invA).

MATERIALS AND METHODS

This was a cross-sectional study conducted in Lusaka district, Zambia. The district has five commercial semi-automated poultry abattoirs of which only two (A and B) granted permission to conduct the study from their premises. The chickens processed at the two abattoirs are distributed in supermarkets and sold to consumers countrywide.

One hundred (100) samples were collected, 50 from each abattoir. The two abattoirs were sampled conveniently and swabs were collected using systematic random sampling method. Every 25th processed broiler carcass was swabbed on the visceral and cloacal surfaces using the one swab, this was done just before being packaged and consequently taken for refrigeration. The cloacal and visceral surfaces were swabbed because they have been reported to harbour more gastrointestinal contents in cases of contaminations [26]. Each swab was then placed in test tube with selenite broth and stored in a cooler box before being transported to the laboratory.

The swabs collected in selenite broth were incubated for 24hours at 37˚C after which they were cultured on Blood agar (Himedia, India), Maconkey agar (Himedia, India) and xylose lysine deoxycholate (XLD) agar (Himedia, India) at the same incubation conditions. Gram staining was performed on the colonies from XLD and Maconkey agars and bacteria that were identified as presumptive Salmonella spp was further inoculated Triple sugar iron agar (TSI) agar (Oxoid, UK) and SIM agar (Oxoid, UK), which were incubated at 37˚C for 18hours. Other biochemical tests for the salmonella spp isolates included; Urease, citrate and Methyl Red Voges Proskauer (MRVP) media (Oxoid, UK).

The colonies identified as salmonella spp were then subjected to serotyping by slide agglutination, according to the Kaufmann- white classification using salmonella polyvalent O and H antisera (Denka Seiken co., Tokyo, Japan).

DNA from the enriched culture was extracted by heating for 10-20min on a heating block. The DNA was used as the template for the PCR assay and the primers pair used targeted the invA gene and are shown below;

22 mer Sal141- 5’ TCATCGCACCGTCAAAGGAACC 3’

26 mer Sal139 –5’ GTGAAATTATCGCCACGTTCGGGCAA 3’

The total mixture for each sample came up to 25µl (24µl of master mix+ 1µl DNA template). The Master mix was prepared as follows;(a) 10× Buffer (2.5µl), (b) dNTP (2.0µl), (c) Primer (forward and reverse) 1.0µl, (d) Distilled water (18.377µl), (e) Enzyme Ex Taq (0.125µl)

Positive and negative test samples were run alongside the template DNA samples. The reaction mixture were run at the following conditions; denaturation at 94°C for 2 min.; thirty-five cycles of amplification at 95°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 30 seconds and the reaction was completed by a final 10 minutes extension at 72°C. Aliquots of amplification products were separated on 0.5% agarose gel in 0.5X Tris Borate Ethylene diamine tetra acetic acid (EDTA) buffer and visualized by ethidium bromide staining and UV transillumination

The antimicrobial susceptibility testing was done using the Kirby-Bauer disc diffusion method on Mueller Hinton Agar (Becton, Dickinson and Company, MD, USA) based on the Clinical Laboratory Standard Institute (CLSI) guidelines [27]. The antibiotic discs (Becton, Dickinson and Company, MD, USA) used included Nitrofurantoin (300µg), Cephoxitin (30µg), Kanamycin (30µg), Doxycycline (30 µg), Co-trimoxazole (1.25/23.75 µg), Amoxicillin and Clavulanic acid (AMC) (20µg/10µg), Tetracycline (30µg), Gentamycin (10µg), Chloramphenicol (30µg), and Oxacillin (1µg).

Figure2: Number of broiler carcasses contaminated with bacteria

Figure 2: PCR detection of Salmonella virulent gene invA, Lane 1 to 4. M, marker with 50 bp ladder, with amplicons being indicated by the arrow. Lane 1 and 2 being the negative and positive controls, respectively, Lane 3 and 4 are the Salmonella isolates of broiler carcasses #76 and #94.

Table 2: Antimicrobial sensitivity for Salmonella isolates from broiler carcasses

S/N Antibiotic Zone Diameter Interpretive Criteria  

(nearest whole mm)*

Size of inhibition Zone (mm) Comment 
Susceptible Intermediate Resistant
1 Nitrofurantoin (300µg) ≥17 15 to 16 ≤14 19 Susceptible
2 Cephoxitin (30µg) ≥18 15 to 17 ≤14 17 intermediate Susceptible
3 Kanamycin (30µg) ≥18 14 to 17 ≤13 17 intermediate Susceptible
4 Doxycycline (30 µg) ≥14 11 to 13 ≤10 27.5 Susceptible
5 Co-trimoxazole (1.25/23.75µg) ≥16 11 to 15 ≤10 20 Susceptible
6 Amoxicillin and Clavulanic acid(AMC) (20µg/10µg) ≥18 14 to 17 ≤13 30 Susceptible
7 Tetracycline (30µg) ≥15 12 to 14 ≤11 10 resistant
8 Gentamicin (10µg) ≥15 13 to 14 ≤12 11 resistant
9 Chloramphenicol (30µg) ≥18 13 to 17 ≤12 17 Partially Susceptible
10 Oxacillin (1µg) ≥13 11 to 12 ≤13 13 Susceptible

*Values obtained from the Clinical Laboratories Standards Institute (CLSI) Guidelines for Performance Standards for Antimicrobial Susceptibility Testing. 

 

RESULTS

a. Bacteria isolated from Broiler carcasses

A total of 100 swabs were collected from abattoir A and abattoir B, 50% coming from each site. The results of the study revealed that only 2 broiler carcasses were contaminated with Salmonella spp. Other bacteria that were isolated from the broiler carcasses included Escherichia coli (E. coli), Proteus spp, and Bacillus spp [table 1]. The most prevalent bacteria was E. coli which was isolated from 72 broiler carcasses, and it coexisted with other microorganisms such as Proteus spp, Salmonella spp and Bacillus spp [Table 1].

b. Molecular detection of Salmonella spp

The two Salmonella isolates that were subjected to PCR with primers that targeted the invA gene revealed amplicons with a band size of 284bp and were identified using gel electrophoresis [Figure 1]. This results therefore demonstrated the presence of invA gene in the Salmonella spp that was isolated from broiler carcasses.

c. Antibiotic sensitivity test of Salmonella enteritidis

The two Salmonella isolates were susceptible to Nitrofurantoin, Doxycycline, Co-trimoxazole, Amoxicillin and Clavulanic acid and Oxacillin. The isolates showed partial susceptibility to Cephoxitin, kanamycin and chloramphenicol. Resistance was observed on tetracycline and gentamicin.

DISCUSSION

From the study Salmonella was isolated from only 2 broiler carcasses (2%), the invA gene was detect from the isolates and they were resistant to tetracycline and gentamicin. In previous studies conducted in Lusaka District, the prevalence of Salmonella in broiler carcasses ranged from 20.53% to 46.15%, from 1998 to 2012, respectively [24, 28-29]. In a study by Hang’ombe et al (1998) a prevalence of 28% of Salmonella in processed broiler carcasses was reported, of which 16.82% was Salmonella enteritidis [28] and in another study the prevalence of Salmonella enteritidis was reported at 20.53% [29].The previous studies sampled both commercially and backyard processed broiler carcasses, therefore comparison of the prevalence is insignificant since the present study sampled commercially processed broiler carcasses only. The low prevalence of Salmonella in the study could be due to hygiene standards in commercial poultry abattoirs. Abattoirs in Lusaka adhere to strict Hazard Analysis Critical Control Point (HACCP) standards throughout the production process, thereby ensuring low microbiological contamination of broiler carcasses [30]. It was further reported that routine Salmonella surveillance activities are conducted by Department of Veterinary Services (DVS) through Central Veterinary Research Institute of Zambia (CVRI) to ensure high standards are upheld and poultry meat sold to public is free of Salmonella [31].

The invA gene which codes for proteins which are necessary for invasion of epithelial cells was present in the Salmonella isolated from commercially broiler carcasses. The isolation of invasive Salmonella serotypes from broiler carcasses in Lusaka district poses a public health risk as contaminated chicken serves as vehicle for transmission when consumed undercooked. Non-typhoidal salmonellosis (NTS) infections are clinically present as self-limiting gastroenteritis [32] but bacteraemia and other complications have been reported in sensitive populations (geriatrics, paediatrics, and immunocompromised individuals) [33, 34]. It is therefore important that poultry abattoirs produce broiler carcasses that are free of Salmonella.

Antibiotic sensitivity test results revealed that the Salmonella isolated from broiler carcasses were resistant to tetracycline and gentamicin. In study by Ulaya et al (2012), it was reported that Salmonella isolated from chickens showed higher resistance to tetracycline, gentamicin, vancomycin, erythromycin and co-trimoxazole [35]. Other bacteria isolated from poultry have also demonstrated multiple antibiotic resistance. In a study by Chishimba et al (2016), they reported high resistance rates of Escherichia coli isolated from poultry to ampicillin (100%), cefotaxime/ceftazidime (100%), tetracycline (59.7%), chloramphenicol (57.1%), and norfloxacin (54.5%) [36]. Tetracycline and gentamicin are extensively used in the poultry industry for treatment of a variety of diseases and also as growth promoters. The continued misuse of tetracycline and gentamicin in rearing of broilers has contributed to the development of resistant bacterial strains [37]. The resistance pattern observed with the Salmonella isolates in the study raises concern on the increasing antibiotics resistance of bacteria isolated from poultry.

CONCLUSION

The study confirmed a prevalence of 2% of a virulent multidrug resistant Salmonella spp in commercially processed broiler carcasses and this raises concerns on the public health risk to consumers of chickens. Furthermore, the study confirmed the resistance to tetracycline and gentamicin, which are commonly used antibiotics in poultry production.

RECOMMENDATIONS

The authors of the study therefore recommend that the Government of Republic of Zambia (GRZ) through the Zambia Medicines Regulatory Authority (ZAMRA) should institute controls on the indiscriminate purchase of antibiotics for livestock production. The on-counter purchase of antibiotics by poultry producers has led to the abuse of the drugs which are reportedly used in none bacterial infections and are often administered at lower doses than recommended. Furthermore, the authors propose the creation of an agency that will investigate the increasing trends of antibiotics resistance in both human and veterinary medicine.

The Department of Veterinary Services through the Central Veterinary Research Institute should continue with the routine Salmonella inspections to monitor the HACCP systems that are established in all the poultry abattoirs in Zambia.

List of References

1. Foley SL, Nayak R, Hanning IB, Johnson TJ, Han J, Ricke SC. Population dynamics of Salmonella enterica serotypes in

commercial egg and poultry production. Applied and Environmental Microbiology. 2011 Jul 1;77(13):4273-9.

2. Heyndrickx M, Vandekerchove D, Herman L, Rollier I, Grijspeerdt K, De Zutter L. Routes for Salmonella contamination of

poultry meat: epidemiological study from hatchery to slaughterhouse. Epidemiology and Infection. 2002 Oct;129(2):253-65.

3. Capita R, Alonso‐Calleja C, Prieto M. Prevalence of Salmonella enterica serovars and genovars from chicken carcasses in

slaughterhouses in Spain. Journal of Applied Microbiology. 2007 Nov 1; 103(5):1366-75.

4. Chotinun S, Rojanasthien S, Unger F, Tadee P, Patchanee P. prevalence and antimicrobial resistance of salmonella isolated

from carcasses, processing facilities and the environment surrounding small scale poultry slaughterhouses in Thailand.

Southeast Asian Journal of Tropical Medicine and Public Health. 2014 Nov 1; 45(6):1392.

5. Chotinun S. The status of hygienic practices of small-scale poultry slaughterhouse in Thailand: An ecohealth approach

(Doctoral dissertation, Chiang Mai University).

6. Chotinun S, Rojanasthien S, Unger F, Tadee P, Patchanee P. prevalence and antimicrobial resistance of salmonella isolated

from carcasses, processing facilities and the environment surrounding small scale poultry slaughterhouses in Thailand.

Southeast Asian Journal of Tropical Medicine and Public Health. 2014 Nov 1; 45(6):1392.

7. Rigby CE, Pettit JR. Changes in the Salmonella status of broiler chickens subjected to simulated shipping conditions.

Canadian Journal of Comparative Medicine. 1980 Oct;44(4):374.

8. Corry JE, Allen VM, Hudson WR, Breslin MF, Davies RH. Sources of Salmonella on broiler carcasses during transportation

and processing: modes of contamination and methods of control. Journal of Applied Microbiology. 2002 Mar 1;92(3):424-32.

9. Olsen EV, Pathirana ST, Samoylov AM, Barbaree JM, Chin BA, Neely WC, Vodyanoy V. Specific and selective biosensor for

Salmonella and its detection in the environment. Journal of Microbiological Methods. 2003 May 1;53(2):273-85.

10. Rasschaert G, Houf K, Godard C, Wildemauwe C, Pastuszczak-Frak M, De Zutter L. Contamination of carcasses with

Salmonella during poultry slaughter. Journal of Food Protection. 2008 Jan;71(1):146-52.

11. World Health Organization. Risk assessments of Salmonella in eggs and broiler chickens. Food & Agriculture Org.; 2002.

12. Luber P. Cross-contamination versus undercooking of poultry meat or eggs—which risks need to be managed first?.

International journal of food microbiology. 2009 Aug 31;134(1-2):21-8.

13. Schwarz S, Kehrenberg C, Walsh TR. Use of antimicrobial agents in veterinary medicine and food animal production.

International journal of antimicrobial agents. 2001 Jun 1;17(6):431-7.

14. Marshall BM, Levy SB. Food animals and antimicrobials: impacts on human health. Clinical microbiology reviews. 2011 Oct

1;24(4):718-33.

15. Foley SL, Lynne AM. Food animal-associated challenges: Pathogenicity and antimicrobial resistance. Journal of animal

science. 2008 Apr 1;86(14_suppl):E173-87.

16. Naik VK. Studies on Isolation and Molecular Characterization of Salmonella Spp. Of Public Health Significance in Chevron

and Chicken Meat (Doctoral dissertation, Chhattisgarh Kamdhenu Vishwavidyalaya, Durg (CG)

17. Marcus SL, Brumell JH, Pfeifer CG, Finlay BB. Salmonella pathogenicity islands: big virulence in small packages. Microbes

and Infection. 2000 Feb 29;2(2):145-56.

18. Hang ombe BM, Isogai E, Mubita C, Isogai N, Silungwe M, Chisenga C, Moonga L, Mulenga E, Yabe J, Takaya A, Yamamoto

T. Detection of invA, spiC, sipC, invF, and hilA in Salmonella isolated from beef and poultry by dot blot hybridization in Zambia.

International Journal of Applied Research in Veterinary Medicine. 2008 Jan 1;6(1):1.

19. Thong KL, Goh YL, Radu S, Noorzaleha S, Yasin R, Koh YT, Lim VK, Rusul G, Puthucheary SD. Genetic diversity of clinical

and environmental strains of Salmonella enterica serotype Weltevreden isolated in Malaysia. Journal of clinical microbiology.

2002 Jul 1;40(7):2498-503.

12

20. Jamshidi A, Kalidari GA, Hedayati M. Isolation and identification of Salmonella Enteritidis and Salmonella Typhimurium from

the eggs of retail stores in Mashhad, Iran using conventional culture method and multiplex PCR assay. Journal of food safety.

2010 Aug 1;30(3):558-68.

21. Malorny B, Hoorfar J, Bunge C, Helmuth R. Multicenter validation of the analytical accuracy of Salmonella PCR: towards an

international standard. Applied and environmental microbiology. 2003 Jan 1;69(1):290-6.

22. Foley SL, Johnson TJ, Ricke SC, Nayak R, Danzeisen J. Salmonella pathogenicity and host adaptation in chicken-associated

serovars. Microbiology and Molecular Biology Reviews. 2013 Dec 1;77(4):582-607.

23. Poultry Association of Zambia, Annual General Meeting Report, 2017

24. Munang’andu HM, Kabilika SH, Chibomba O, Munyeme M, Muuka GM. Bacteria isolations from broiler and layer chicks in

Zambia. Journal of pathogens. 2012 Sep 3;2012.

25. Bolder NM. Microbial challenges of poultry meat production. World’s Poultry Science Journal. 2007 Sep 1;63(03):401-11.

26. Northcutt JK, Berrang ME, Dickens JA, Fletcher DL, Cox NA. Effect of broiler age, feed withdrawal, and transportation on

levels of coliforms, Campylobacter, Escherichia coli and Salmonella on carcasses before and after immersion chilling. Poultry

Science. 2003 Jan 1;82(1):169-73.

27. Clinical and Laboratory Standards Institute, Performance Standards for Antimicrobial Susceptibility Testing, 19th Informational

Supplement M100-S19, Clinical and Laboratory Standards Institute, Wayne, Pa, USA, 2009.

28. Hang’ombe BM, Sharma RN, Skjerve E, Tuchili LM. Occurrence of Salmonella enteritidis in pooled table eggs and marketready

chicken carcasses in Zambia. Avian diseases. 1999 Jul 1:597-9.

29. Hang’ombe BM, Sharma NR, Skjerve E, Tuchili LM. Isolation of bacteria during processing of chicken carcasses for the

market in Lusaka, Zambia. Veterinarski arhiv. 1999 Sep 22;69(4):191-7.

30. Nyeleti C, Cogan TA, Kabilika SH, Katongo JC, Nyirenda S, Silomba S, Sinyangwe PG, Humphrey TJ. Antibiotic and

disinfectant resistance of Salmonella serovars isolated from the poultry production environment in Zambia. Bulletin of Animal

Health and Production in Africa. 2004;52(3):168-75.

31. Government of the Republic of Zambia. Department of Veterinary and Tsetse Control Services Annual Reports for the year,

2013. Lusaka: Government Printer, 2014.

32. Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O’brien SJ, Jones TF, Fazil A, Hoekstra RM. The global burden of

nontyphoidal Salmonella gastroenteritis. Clinical Infectious Diseases. 2010 Mar 15;50(6):882-9.

33. Salehi TZ, Mahzounieh M, Saeedzadeh A. Detection of invA gene in isolated Salmonella from broilers by PCR method. Int.

J. Poult. Sci. 2005;4(8):557-9.

34. Dhanoa A, Fatt QK. Non-typhoidal Salmonella bacteraemia: epidemiology, clinical characteristics and its’ association with

severe immunosuppression. Annals of clinical microbiology and antimicrobials. 2009 May 18;8(1):15.

35. Ulaya W, Hang BM. Distribution of virulence genes and antimicrobial susceptibility of Salmonella isolated from dogs and

chickens in Zambia. International Journal for Agro Veterinary and Medical Sciences. 2012;6(5):360-7.

36. Chishimba K, Hang’ombe BM, Muzandu K, Mshana SE, Matee MI, Nakajima C, Suzuki Y. Detection of extended-spectrum

beta-lactamase-producing Escherichia coli in market-ready chickens in Zambia. International journal of microbiology. 2016 Apr

17;2016.

37. Silbergeld EK, Graham J, Price LB. Industrial food animal production, antimicrobial resistance, and human health. Annu.

Rev. Public Health. 2008 Apr 21;29:151-69.

 

Facebooktwittergoogle_pluslinkedinmail

DENTAL CARIES ON PERMANENT DENTITION IN PRIMARY SCHOOL CHILDREN — NDOLA, ZAMBIA, 2017

N Simushi,S A Nyerembe,1 R Sasi,S Siziya1

1.Michael Chilufya Sata School of Medicine, Copperbelt University, Ndola Campus , Zambia.

Correspondence: Nasilele Simushi  (nsimushi@yahoo.com)

Download PDF


Citation style for this article: Simushi N, Nyerembe S A, Sasi R, Siziya S. Dental caries on permanent dentition in primary school children — ndola, zambia, 2017 . Health Press Zambia Bull. 2018 2(4); pp 5-16.


Dental caries is a major oral health problem affecting 60-90% of children in developing countries [1]. This study aimed to determine the prevalence of caries and associated factors in permanent dentition among primary school children. A cross sectional study was conducted using a modified 2007 WHO questionnaire and a 1997 WHO oral health survey clinical examination tool. Ethical approval and permission to conduct the study were obtained from relevant authorities. The Chi-squared test was used to determine associations, with the level of significance set at the 5%. A total of 365 children were enrolled of which 48.5% were males. The age range was 5-17 years. The overall prevalence of caries in permanent teeth was 47(12.9 %). Geographical location (p=0.022) and family income (p= 0.014) were significantly associated with caries, although only family income was statistically significant (odds ratio [OR] = 0.65, 95% confidence interval [CI] = 0.46 – 0.92) in a multivariate analysis. The lower left first molar (9.0%) was the most often affected. None of the children had a tooth with a filled cavity. Less than half, 177 (48.5%), brushed their teeth for 2 or more minutes daily and only 71 (19.5%) had been for a dental check-up. Promotion of regular dental check-ups in schools and application of fissure sealants to children at high risk of developing caries is recommended.

Introduction

Dental caries is a progressive and irreversible microbial disease that affects calcified dental hard tissues. Cariogenic bacteria, fermentable carbohydrates, susceptible teeth, and time are the key etiological factors [2]. Carries occurs when organic acids resulting from metabolism of sugars by bacteria in dental plaque cause a loss of minerals in enamel and dentine resulting in a cavity [3]. Most decay is untreated in most developing countries [4,5], affecting the growth and wellbeing of millions of children [6,7]. Most African countries, including Zambia, have a poor dentist: population ratio of 1:150,000 compared with 1:2000 in most industrialized countries [8].
A study in West Bengal, India, showed a significant higher prevalence of caries on permanent dentition in girls (30.9%) than boys (25.4%) [9]. A similar study in India also showed 73.5% in girls and 26.2% in boys [10]. The higher prevalence in girls could be associated with earlier eruption of permanent teeth in females than males [11,12]. However, another study [13] reported a higher prevalence of caries in boys (45.9%) than girls (40.9%).
Occupational status, income, and education are related to dental caries. A study conducted in Ibadan, Nigeria showed that populations with the worst oral health are those with the highest poverty rates and the lowest education [14]. In another study done in Nigeria [15], a higher prevalence of dental caries was recorded among children of high social class (46.9%) compared with those from low social class (12.6%).
Some studies showed an association between family size and dental caries. A study done in Mexico showed that children in large families had a higher prevalence of dental caries than in small families [16].
Prevalence of dental caries and associated factors in Zambia are not well documented. A study done in 1996 reported an increase in caries among the youth and young adults [17]. Therefore, this study aimed to determine the prevalence of caries and associated factors in permanent dentition among primary schoolchildren in Ndola District, Zambia.

Methods
A cross sectional study involving 365 children in primary schools was conducted. A pilot study of 36 children from one urban and one peri-urban area was used to obtain information to calculate the sample size. Consent letters were given to 385 children, and out of this 365 (94.8%) presented a written parental consent to participate. This study had dental caries as the dependent variable while age, sex, and geographical location were independent variables.
Data were collected between January and March 2017 using a structured questionnaire. The questionnaire was administered to children by trained assistants. A convenience sample of three urban and three peri-urban primary schools in Ndola District were selected from the list of 57 primary schools obtained from the District Education Board Secretary’s office (DEBS). Children were selected by systematic random sampling.
Permission was obtained from Copperbelt University School of Medicine administration, the DEBS office, and Principals of each school before commencing the research. Ethical approval was obtained from the Tropical Diseases Research Centre (IRB NO. 00002911, FWA NO. 00003729).

Table 1: Distributions of participants by demographic characteristics

  Total Male Female  
Demographic variable n (%) n (%) n (%) p value
Age (years)  
5- 10 251 (100) 125 (49.8) 126 (50.2) 0.458
11-17 114 (100) 52 (45.6) 62 (54.4)
Geographical location  
Urban 184 (100) 81 (44.0) 103 (56.0) 0.085
Peri- Urban 181 (100) 96 (53.0) 85 (47.0)

Table 2: Frequency distribution of participants according to caries experience by age

With caries
Age (years) Total n (%)
5, 6 54 2 (3.7)
7 63 6 (9.5)
8 66 12 (18.2)
9 28 4 (14.3)
10 40 6 (15.0)
11 41 9 (22.0)
12 35 4 (11.4)
13 – 17 38 4 (10.5)

Table 3:  Decayed, missing, and filled teeth among 365 children

  Total (Minimum, maximum) Mean
Decayed 47 (1, 7) 0.129
Missing 3 (0, 3) 0.008
Filled 0 (0, 0) 0
DMFT* 49 (0, 7) 0.134

*D- Decayed, M- Missing, F- Filling, T-Tooth

Table 4:  Distribution of caries experience according to sex, geographical location, and family size

  Total Caries free With caries p value
Variable  n (%) n (%) n (%)
Sex        
Male 177 (100) 153 (86.4) 24 (13.6) 0.706
Female 188 (100)  165 (87.8) 23 (12.2)  
School        
Urban 184 (100) 153 (83.2) 31 (16.8) 0.022
Peri-urban 181 (100) 165 (91.2) 16 (8.8)  
Family size        
Up to 5 302 (100) 262 (86.8) 40 (13.2) 0.646
More than 5 63 (100) 56 (88.9) 7 (11.1)  

 Table 5:  Distributions of dental caries according to family income, mother and father’s level of education.

Caries Status
Total Caries free With caries
Demographic

Characteristics

n (%) n (%) n (%) p value
Family  income
< K 600 153 (100) 137 (89.5) 16 (10.5) 0.014
K 600 + 107 (100) 84 (78.5) 23 (21.5)
Mother education
Up to primary 100 (100) 88 (88.0) 12 (12.0) 0.391
Secondary / Tertiary 171 (100) 144 (84.2) 27 (15.8)
Father education
Up to primary 55  (100) 51 (92.7) 4 (7.3) 0.097
Secondary / Tertiary 212 (100) 178 (84.0) 34 (16.0)

* Numbers are not adding up because some respondents did not provide information

Figure 1: Percentage distribution of Dental caries on first molars among participants

 

The modified WHO criterion (WHO, 1997) for caries diagnosis was used. The clinical examinations were carried out by four examiners in a classroom with wide open widows to provide natural light. Subjects leaned on a pillow placed on the lap of the examiner with the head facing upward and the mouth opened. To prevent transmission of infection, a new or disinfected round-ended probe, examination mirror, pair of examination gloves, and face mask was used for each child. Hand washing was exercised accordingly. The data was recorded on individual questionnaires and children with diagnoses of caries were given notes to take to their parents so that they could take them for treatment to nearby dental clinics.
Data were entered and analyzed using SPSS version 20 to generate frequencies and cross-tabulations. Chi-square test was used to compare differences of the outcome measure (dental caries) and was assumed significant when p value was ≤0.05. Multivariate analysis was done for variables that were significant (family income and geographic location) and associations were assumed when the 95% confidence intervals excluded 1.
Results

A total of 365 children aged 5 to 17 years were enrolled in this study, out of these 177 (48.5%) were males. Distributions of participants according to age and geographical location of the school by sex were statistically non-significant as shown in Table 1. Less than half 177 (48.5%) reported brushing their teeth for 2 or more minutes daily and only 71 (19.5%) had been for dental check-up.
Table 2 shows frequency distribution of participants according to caries experience by age. Altogether, 47(12.9%) of the participants had caries .The most affected age group was 11 years old; 22.0% of them had caries.
Mean decayed, missing, and filled teeth (DMFT) components are presented in Table 3. No subject had a tooth with a filled cavity.
Table 4 shows distributions of caries experience by sex, geographical location, and family size. School geographical location was significantly (p=0.022) associated with dental caries, as 31 of the 184 (16.8%) children living in urban areas were affected compared with 16 of 181 (8.8%) of those from peri-urban schools.
The lower left first molar (9.0%) was the most frequently affected tooth by caries, followed by the lower right first molar (6.8%);
Table 5 shows distributions of dental caries according to family income, mother’s education, and father’s education. Family income was significantly (p= 0.014) associated with caries experience with more children from families with a monthly income of >K 600 were found with caries than those from low income families (21.5% versus 10.5%).
Geographical location and family income were included in logistic regression model. Geographical location (OR = 1.22, 95% CI = 0.85-1.75) was not independently associated with dental caries but family income was significantly associated with dental caries (OR = 0.65, 95% CI = 0.46 – 0.92). Children from families with an income of <K 600 were 35% less likely to have dental caries compared with children from families with income of K 600 or more.

Discussion
The overall prevalence of dental caries in the current study was 12.9%, 13.6% in boys, and 12.2% in girls. Geographical location was statistically associated with dental caries, as children living in urban areas were more affected than those in peri-urban areas (16.8% compared with 8.8%). These results are consistent with a study done in Burkina Faso that revealed a higher prevalence in urban (46%) than rural (32%) areas [18]. Similarly, a study in Zimbabwe [19] showed more caries in urban schoolchildren (59.5%) than in rural schoolchildren (40.8%). The results also showed a mean DMFT of 1.29 for urban schoolchildren and 0.66 for rural schoolchildren. The higher prevalence of caries in Ndola urban areas could be due to inadequate oral hygiene combined with easy access to cariogenic foods and sugary drinks [17].
The current study found a positive relationship between higher family income and more dental caries. This finding correlates with a study done in Nigeria [15] where the prevalence of caries was higher among children of high (46.9%) than low (12.6%) social class. In contrast, in the United States, children from high income families had a lower caries experience (16.3%) compared with those in lower income groups (24.1%) [20].
The current study did not reveal a significant association between family size and dental caries. The findings are contrary to a study done in Mexico which revealed a significant association between family size and dental caries [16] on permanent dentition. In a study done in Argentina, low parental level of education was associated with the high level of caries experience [21]. However, the current study showed no statistically significant association between mother’s level of education or father’s level of education and dental caries.
The occurrence of dental caries showed the lower left first molar (9.0%) to be the most often affected tooth, followed by the lower right first molar (6.8%). These findings could be attributed to the early eruption of these teeth [22]. These results agree with the results of a study in South Africa [23] that found that the lower molar teeth experienced a higher incidence of caries than upper molars. In contrast, in a study done in Nigeria, a higher incidence of dental caries was found in second molars compared with first molars [24].
The highest mean DMFT in this study was found in children aged 11 years; 22.0% of them had missing or decayed teeth, while the F component was zero.

One of the limitations of the study was that the sample was not randomly selected. Furthermore, the participants were those that were present at school during data collection. Those absent could have been different from those present and the results may not be generalizable to the rest of the children who did not take part in the study.

Conclusions and Recommendations

Dental caries prevalence among primary schoolchildren in Ndola district was low. However, dental caries prevalence was higher in urban and high-income families than in rural and low income families. It was also noted that there were few participants that had dental check-ups, and among these, none had fillings. Regular dental check-ups should be conducted more in urban schools and fissure sealants applied to children at high caries risk.

Competing Interests

The authors declare that they have no competing interests.

Acknowledgments
We would like to acknowledge the Dominican Sisters for funding this study. We would also like to thank all parents who gave permission to their children’s participation in the study. We are grateful to the DEBS office and Head teachers from six schools for allowing us to conduct the study. Lastly, our acknowledgements go to Michael Chilufya Sata University, School of Medicine for according us with an opportunity to conduct this study.

 

References

1. Petersen PE, Bourgeois D, Ogawa H, Estupinan-Day S, Ndiaye C: The global burden of oral diseases and risks to oral health. Bulletin of theWorld Health Organisation 2005;83:661-69.

2. Harris R, Nicoll AD, Adair PM, Pine MC. Risk factors for dental caries in young children: a systematic review of the literature. Community Dental Health 2004;21(Suppl):71–85

3. Puska P, Porter D, Petersen PE. dental diseases and oral health World Health Organization 2003 Available from: http://www.who.int/oral_health/publications/en/orh_fact_sheet.pdf

4. Edelstein B L. The dental caries pandemic and disparities problem, BMC Oral Health 2006; 6, (supp1).

5. Petersen PE, Poulsen VJ, Ramahaleo JJ, Ratsifaritara C. Dental caries and dental health behaviour situation among 6- and 12-year old urban schoolchildren in Madagascar. African Dental Journal 1991;5:1–7.

6. Acs G. Lodolini G. Kaminsky S, Cisneros GJ. Effect of nursing caries on body weight in a pediatric population. Pediatric Dentistry 1992;14(5):302-305.

7. Sheiham A, Watt RG. The common risk factor approach: a rational basis for promoting oral health, Community Dentistry and Oral Epidemiology 2000;28(6):399–406.

8. Parkash H, Mathur VP, Duggal R, Jhuraney B. Dental Workforce issues: A global concern. Journal of Dental Education 2006;70(Suppl 11):22-26

9. Das D, Misra J, Mitra M, Bhattacharya B, Bagchi A. Prevalence of dental caries and treatment needs in children in coastal areas of West Bengal. Contemporary Clinical Dentistry 2013; 4(4):482-487.

10. Reddy KS, Reddy S, Ravindhar P, Balaji K, Reddy H, Reddy A. Prevalence of dental caries among 6–12 years school children of Mahbubnagar District, Telangana State, India: A cross-sectional study. Indian Journal of Dental Science 2017;9:1-7.

11. Höffding J, Maeda M, Yamaguchi K, Tsuji H, Kuwabara S, Nohara Y, et al. Emergence of permanent teeth and onset of dental stages in Japanese children. Community Dental Oral Epidemiology 1984;12:55-58.

12. Magnusson TE. Emergence of permanent teeth and onset of dental stages in the population of Iceland. Community Dental Oral Epidemiology 1976;4:30-37.

13. Kalita C, Choudhury B, Sarmah PC, Saikia AK. Caries prevalence of school going boys and girls according to sweet taking frequency among different age groups in and around Guwahati city. Journal of Pediatric Dentistry 2015;3:82-87.

14. Teodora Timiş, Dănilă I. Socioeconomic status and oral health, The Journal of Preventive Medicine 2005;13(1-2):116-121.
15. Popoola BO, Denloye OO, Iyun OI. Influence of parental socioeconomic status on caries prevalence among children seen at the university college hospital, Ibadan. Annals of Ibadan Postgraduate Medicine 2013;11(2):81-86.

16. Rosado AJ C, Medina-S C E, Rosado J FC, Sanchez A A V, Maupome G & Burgos L A. Dental caries and associated factors in Mexican schoolchildren aged 6–13 years. Acta Odontologica Scandinavica 2005;63:245–251.

17. Kabwe JK. The distribution of dental diseases and disorders observed in an urban dental clinic in Zambia. Odonto-stomatologie Tropicale 1996;73(1):27-32.

18. Varenne B, Petersen PE, Ouattara S. Oral health status of children and adults in urban and rural areas of Burkina Faso, Africa. International Dental Journal 2004;54:83–89.

19. Mafuvadze BT, Mahachi L, Mafuvadze B. Dental caries and oral health practice among 12 year old school children from low socio-economic status background in Zimbabwe. The Pan African Medical Journal 2013;14:164.

20. Dye BA, Tan S, Smith V, Lewis BG, Barker LK, Thornton-Evans G. Trends in oral health status: United Statistics, 1988–1994 and 1999–2004. National Center for Health Statistics. Vital Health Status 2007;11(248):4.

21. Ravera E, Sanchez GA, Squassi AF, Bordoni N. Relationship between dental status and family, school and socioeconomic level. Acta Odontol Latinoam2012;25:140–149.

22. Kjær I. Mechanism of human tooth eruption: review article including a new theory for future studies on the eruption process. Scientifica 2014;2014, Article ID 341905.

23. Reddy M, Singh S. Dental caries status in six-year-old children at health promoting schools in KwaZulu-Natal, South Africa. South African Dental Journal 2015;70(9):396 – 401.

24. Akpata ES. Oral health in Nigeria. International Dental Journal 2004;54(S6):361–366.

Facebooktwittergoogle_pluslinkedinmail